Human TPP1(Tripeptidyl Peptidase I) ELISA Kit

Human TPP1(Tripeptidyl Peptidase I) ELISA Kit

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
DLR-TPP1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates or other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
DLR-TPP1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates or other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Tripeptidyl Peptidase I (TPP1)ELISA Kit
201-12-2521	SunredBio	96 tests	EUR 440
This Tripeptidyl Peptidase I ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
20-abx153364	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx358322-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Tripeptidyl Peptidase I(TPP1)ELISA Kit
QY-E01705	Qayee Biotechnology	96T	EUR 361

Human Tripeptidyl Peptidase I ELISA Kit (TPP1)
RK02437	Abclonal	96 Tests	EUR 521

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
4-SEC828Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tripeptidyl Peptidase I elisa. Alternative names of the recognized antigen: CLN2 GIG1 LPIC Tripeptidyl aminopeptidase Lysosomal pepstatin-insensitive protease Ceroid-Lipofuscinosis, Neuronal 2, Late Infantile Cell growth-inhibitin Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx004789	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx004302	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx178719	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx116291	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx129223	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx129835	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
abx145299-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx174934	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Tripeptidyl Peptidase I (TPP1) Antibody
abx029244-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
abx029244-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
abx238894-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx334373	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Tripeptidyl Peptidase I (TPP1)
4-RPC828Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O14773 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 38.2kDa Isoelectric Point: 5.7
Description: Recombinant Human Tripeptidyl Peptidase I expressed in: E.coli

Recombinant Tripeptidyl Peptidase I (TPP1)
4-RPC828Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O89023 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 43.2kDa Isoelectric Point: 5.9
Description: Recombinant Mouse Tripeptidyl Peptidase I expressed in: E.coli

Human Tripeptidyl Peptidase I (TPP1) Protein
20-abx166794	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
20-abx154796	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Pig Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx360652-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx358877-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx355837-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx363635-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx364262-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tripeptidyl Peptidase I (TPP1) in Tissue homogenates and other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tripeptidyl Peptidase I (TPP1) in Tissue homogenates and other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tripeptidyl Peptidase I (TPP1) in Tissue homogenates and other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tripeptidyl Peptidase I (TPP1) in Tissue homogenates and other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
4-SEC828Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tripeptidyl Peptidase I elisa. Alternative names of the recognized antigen: CLN2 GIG1 LPIC Tripeptidyl aminopeptidase Lysosomal pepstatin-insensitive protease Ceroid-Lipofuscinosis, Neuronal 2, Late Infantile Cell growth-inhibitin Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Tripeptidyl Peptidase I (TPP1) CLIA Kit
abx197847-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Tripeptidyl Peptidase I (TPP1) CLIA Kit
20-abx493920	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human TPP1 (Tripeptidyl Peptidase I)
ELK3828	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tripeptidyl Peptidase I (TPP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tri Show more
Description: A sandwich ELISA kit for detection of Tripeptidyl Peptidase I from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) Protein
20-abx167349	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tripeptidyl Peptidase I (TPP1) Antibody (HRP)
20-abx338092	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody (FITC)
20-abx338093	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody (Biotin)
20-abx338094	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Tripeptidyl Peptidase I (TPP1) CLIA Kit
20-abx493921	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human)
4-PAC828Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1)

Guinea pig Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx357276-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Mouse TPP1 (Tripeptidyl Peptidase I)
ELK6821	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tripeptidyl Peptidase I (TPP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tri Show more
Description: A sandwich ELISA kit for detection of Tripeptidyl Peptidase I from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

CLIA kit for Human TPP1 (Tripeptidyl Peptidase I)
E-CL-H0954	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's TPP1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human TPP1 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human TPP1 (Tripeptidyl Peptidase I) in samples from Serum, Plasma, Cell supernatant

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse)
4-PAC828Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1)

Recombinant Human Tripeptidyl-Peptidase I/TPP1 (C-6His)
CA36-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human Tripeptidyl-Peptidase I/TPP1 (C-6His)
CA36-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human Tripeptidyl-Peptidase I/TPP1 (C-6His)
CA36-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human Tripeptidyl-Peptidase I/TPP1 (C-6His)
CA36-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), APC
4-PAC828Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), Biotinylated
4-PAC828Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Biotin.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), Cy3
4-PAC828Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Cy3.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), FITC
4-PAC828Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with FITC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), HRP
4-PAC828Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with HRP.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), PE
4-PAC828Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with PE.

ELISA kit for Human TPP1 (Tripeptidyl Peptidase ?)
E-EL-H1479	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TPP1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPP1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TPP1 (Tripeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant

Human Tripeptidyl-peptidase 1(TPP1) ELISA kit
CSB-EL024113HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tripeptidyl-peptidase 1(TPP1) ELISA kit
1-CSB-EL024113HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1(TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tripeptidyl- peptidase 1, TPP1 ELISA KIT
ELI-16982h	Lifescience Market	96 Tests	EUR 824

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), APC
4-PAC828Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC828Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Biotin.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), Cy3
4-PAC828Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Cy3.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), FITC
4-PAC828Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with FITC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), HRP
4-PAC828Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with HRP.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), PE
4-PAC828Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with PE.

Bovine Tripeptidyl- peptidase 1, TPP1 ELISA KIT
ELI-40084b	Lifescience Market	96 Tests	EUR 928

Mouse Tripeptidyl- peptidase 1, Tpp1 ELISA KIT
ELI-40085m	Lifescience Market	96 Tests	EUR 865

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), APC-Cy7
4-PAC828Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC-Cy7.

ELISA kit for Human Tripeptidyl-peptidase 1 (TPP1)
KTE60145-48T	Abbkine	48T	EUR 332
Tripeptidyl-peptidase 1 is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inac Show more
Description: Quantitative sandwich ELISA for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tripeptidyl-peptidase 1 (TPP1)
KTE60145-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Tripeptidyl-peptidase 1 is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inac Show more
Description: Quantitative sandwich ELISA for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tripeptidyl-peptidase 1 (TPP1)
KTE60145-96T	Abbkine	96T	EUR 539
Tripeptidyl-peptidase 1 is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inac Show more
Description: Quantitative sandwich ELISA for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC828Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC-Cy7.

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
DLR-TPP2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Tripeptidyl-Peptidase 2 (TPP2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
DLR-TPP2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Tripeptidyl-Peptidase 2 (TPP2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Tripeptidyl- peptidase 2, TPP2 ELISA KIT
ELI-17203h	Lifescience Market	96 Tests	EUR 824

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RDR-TPP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RDR-TPP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RD-TPP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit
RD-TPP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Tripeptidyl- peptidase 2, Tpp2 ELISA KIT
ELI-17186m	Lifescience Market	96 Tests	EUR 865

Bovine Tripeptidyl- peptidase 2, TPP2 ELISA KIT
ELI-29001b	Lifescience Market	96 Tests	EUR 928

Anti-Tripeptidyl Peptidase II Antibody
A06668	BosterBio	100ul/vial	EUR 442
Description: Rabbit Polyclonal Tripeptidyl Peptidase II Antibody. Validated in WB and tested in Human.

Tripeptidyl-Peptidase 2 (TPP2) Antibody
20-abx004914	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tripeptidyl Peptidase Ii (TPP2) Antibody
20-abx116292	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tripeptidyl-Peptidase 2 (TPP2) Antibody
20-abx141860	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Tripeptidyl-Peptidase 1 (CLN2) Antibody
20-abx142275	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Tripeptidyl-Peptidase 2 (TPP2) Antibody
20-abx321789	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Tripeptidyl-Peptidase 1 (CLN2) Antibody
abx430059-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Tpp1/ Rat Tpp1 ELISA Kit
ELI-36485r	Lifescience Market	96 Tests	EUR 886

TPP1 ELISA KIT|Human
EF003763	Lifescience Market	96 Tests	EUR 689

Human Pyroglutamyl-Peptidase I (PGPEP1) ELISA Kit
abx382184-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Kinase Library I
HKIN-I	Real Time Primers	1 set	EUR 450

Human Drug Detoxication I
HDTX-I	Real Time Primers	1 set	EUR 548

Human TPP1 PicoKine ELISA Kit
EK2042	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human TPP1 in cell culture supernates, serum and plasma (heparin, EDTA).

TPP1 ELISA Kit (Human) (OKAN06104)
OKAN06104	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

TPP1 ELISA Kit (Human) (OKBB01409)
OKBB01409	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Tripeptidyl-peptidase 1, also known as Lysosomal pepstatin-insensitive protease, is an enzyme that in humans is encoded by the TPP1 gene. The human gene TPP1 encodes a member of the sedolisin family of serine proteases. The human gene has 13 exons and locates at the chromosome band 11p15. This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

TPP1 ELISA Kit (Human) (OKCD00354)
OKCD00354	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Lysosomal serine protease with tripeptidyl-peptidase I activity. May act as a non-specific lysosomal peptidase which generates tripeptides from the breakdown products produced by lysosomal proteinases. Requires substrates with an unsubstituted N-terminus (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

TPP1 ELISA Kit (Human) (OKDD00573)
OKDD00573	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.063 ng/mL

Canine TPP1 ELISA KIT
ELI-51931d	Lifescience Market	96 Tests	EUR 928

Human Cytokine Primer Library I
HCA-I	Real Time Primers	1 set	EUR 450

Pyroglutamyl-Peptidase I (Recombinant)
20-abx073375	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Human Colon Cancer Primer Library I
HCCP-I	Real Time Primers	1 set	EUR 548

Human DNA Repair Primer Library I
HDRL-I	Real Time Primers	1 set	EUR 548

Human Drug Transporter I Primer Library
HDTP-I	Real Time Primers	1 set	EUR 548

Human Interferon Type I Signaling Primer Library
HIFN-I	Real Time Primers	1 set	EUR 548

Human Cancer Driver Gene I Primer Library
HCDG-I	Real Time Primers	1 set	EUR 645

TPP1 ELISA Kit (Mouse) (OKCD08264)
OKCD08264	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: This gene encodes a lysosomal serine protease that cleaves N-terminal tripeptides from protein substrates. The encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. At the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. Mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

TPP1 ELISA Kit (Mouse) (OKDD00789)
OKDD00789	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: This gene encodes a lysosomal serine protease that cleaves n-terminal tripeptides from protein substrates. the encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. at the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.055ng/mL

Pyroglutamyl-Peptidase I (PGPEP1) Antibody
abx026384-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Pyroglutamyl-Peptidase I (PGPEP1) Antibody
abx026384-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dipeptidyl Peptidase I (DPPI) Antibody
abx018198-100ug	Abbexa	100 ug	EUR 342
Shipped within 5-10 working days.

Pyroglutamyl-Peptidase I (PGPEP1) Antibody
20-abx114934	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Pyroglutamyl-Peptidase I (PGPEP1) Antibody
abx236364-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Signal Peptidase I (lepB) Antibody
20-abx300297	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Signal Peptidase I (lepB) Antibody
20-abx300726	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pyroglutamyl-Peptidase I (PGPEP1) Antibody
20-abx002653	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse Cytokine Primer Library I
MCA-I	Real Time Primers	1 set	EUR 450

Rat Cytokine Primer Library I
RCA-I	Real Time Primers	1 set	EUR 548

PGPEP1 Pyroglutamyl-Peptidase I Human Recombinant Protein
PROTQ9NXJ5	BosterBio	Regular: 20ug	EUR 317
Description: PGPEP1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 232 amino acids (1-209) and having a molecular mass of 25.5kDa.;PGPEP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Mouse DNA Repair Primer Library I
MDRL-I	Real Time Primers	1 set	EUR 645

TPP1 antibody
70R-13534	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal TPP1 antibody

TPP1 antibody
70R-20940	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TPP1 antibody

TPP1 Antibody
32932-100ul	SAB	100ul	EUR 252

TPP1 Antibody
DF7425	Affbiotech	200ul	EUR 304
Description: TPP1 Antibody detects endogenous levels of total TPP1.

TPP1 Antibody
1-CSB-PA024113GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TPP1 Antibody
1-CSB-PA024113LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

TPP1 siRNA
20-abx905753	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPP1 siRNA
20-abx937853	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPP1 siRNA
20-abx937854	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPP1 Antibody
ABD7425	Lifescience Market	100 ug	EUR 438

anti-TPP1
YF-PA10990	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to TPP1

anti-TPP1
YF-PA10991	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TPP1

anti-TPP1
YF-PA10992	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to TPP1

anti-TPP1
YF-PA10993	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to TPP1

Escherichia coli Signal peptidase I (lepB)
1-CSB-EP360447ENV	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 43.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Signal peptidase I(lepB),partial expressed in E.coli

Mycobacterium tuberculosis Signal peptidase I (lepB)
1-CSB-EP604637MVZ	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 38.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mycobacterium tuberculosis Signal peptidase I(lepB),partial expressed in E.coli

Mycobacterium tuberculosis Signal peptidase I (lepB)
1-CSB-YP604637MVZ	Cusabio	EUR 679.00 EUR 335.00 EUR 2172.00 EUR 1051.00 EUR 1442.00 EUR 435.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 24.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mycobacterium tuberculosis Signal peptidase I(lepB),partial expressed in Yeast

Signal Peptidase I (LEPB) Antibody (HRP)
20-abx300298	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Signal Peptidase I (LEPB) Antibody (FITC)
20-abx300299	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Signal Peptidase I (LEPB) Antibody (Biotin)
20-abx300300	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Signal Peptidase I (LEPB) Antibody (HRP)
20-abx300727	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Signal Peptidase I (LEPB) Antibody (FITC)
20-abx300728	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Signal Peptidase I (LEPB) Antibody (Biotin)
20-abx300729	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human TPP1 shRNA Plasmid
20-abx950857	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TPP1 Recombinant Protein (Human)
RP032686	ABM	100 ug	Ask for price

TPP1 Blocking Peptide
DF7425-BP	Affbiotech	1mg	EUR 195

TPP1 Conjugated Antibody
C32932	SAB	100ul	EUR 397

TPP1 cloning plasmid
CSB-CL024113HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1692 Sequence: atgggactccaagcctgcctcctagggctctttgccctcatcctctctggcaaatgcagttacagcccggagcccgaccagcggaggacgctgcccccaggctgggtgtccctgggccgtgcggaccctgaggaagagctgagtctcacctttgccctgagacagcagaatgtgg Show more
Description: A cloning plasmid for the TPP1 gene.

TPP1 Rabbit pAb
A6269-100ul	Abclonal	100 ul	EUR 308

TPP1 Rabbit pAb
A6269-200ul	Abclonal	200 ul	EUR 459

TPP1 Rabbit pAb
A6269-20ul	Abclonal	20 ul	Ask for price

TPP1 Rabbit pAb
A6269-50ul	Abclonal	50 ul	Ask for price

TPP1 Rabbit pAb
A5627-100ul	Abclonal	100 ul	EUR 308

TPP1 Rabbit pAb
A5627-200ul	Abclonal	200 ul	EUR 459

TPP1 Rabbit pAb
A5627-20ul	Abclonal	20 ul	EUR 183

TPP1 Rabbit pAb
A5627-50ul	Abclonal	50 ul	EUR 223

TPP1 Polyclonal Antibody
ABP60740-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of TPP1 from Human, Mouse, Rat. This TPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90

TPP1 Polyclonal Antibody
ABP60740-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of TPP1 from Human, Mouse, Rat. This TPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90

TPP1 Polyclonal Antibody
ABP60740-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of TPP1 from Human, Mouse, Rat. This TPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90

anti- TPP1 antibody
FNab08894	FN Test	100µg	EUR 548.75
Immunogen: tripeptidyl peptidase I Uniprot ID: O14773 Gene ID: 1200 Research Area: Neuroscience, Metabolism
Description: Antibody raised against TPP1

TPP1 Polyclonal Antibody
ES11280-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TPP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TPP1 Polyclonal Antibody
ES11280-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TPP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-TPP1 antibody
PAab08894	Lifescience Market	100 ug	EUR 386

Anti-TPP1 Antibody
PB9899	BosterBio	100ug/vial	EUR 334

pCMV-SPORT6-TPP1
PVT13794	Lifescience Market	2 ug	EUR 391

Anti-TPP1 antibody
STJ27594	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.

Human TPP1(Tripeptidyl Peptidase I) ELISA Kit