Human TPP1(Tripeptidyl Peptidase I) ELISA Kit

Human TPP1(Tripeptidyl Peptidase I) ELISA Kit

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

RDR-TPP1-Hu-48Tests 48 Tests
EUR 544

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

RDR-TPP1-Hu-96Tests 96 Tests
EUR 756

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

RD-TPP1-Hu-48Tests 48 Tests
EUR 521

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

RD-TPP1-Hu-96Tests 96 Tests
EUR 723

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

DLR-TPP1-Mu-48T 48T
EUR 527
  • Should the Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates or other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

DLR-TPP1-Mu-96T 96T
EUR 688
  • Should the Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates or other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

RDR-TPP1-Mu-48Tests 48 Tests
EUR 557

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

RDR-TPP1-Mu-96Tests 96 Tests
EUR 774

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

RD-TPP1-Mu-48Tests 48 Tests
EUR 533

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

RD-TPP1-Mu-96Tests 96 Tests
EUR 740

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

20-abx153364
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx358322-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Tripeptidyl Peptidase I (TPP1)ELISA Kit

201-12-2521 96 tests
EUR 440
  • This Tripeptidyl Peptidase I ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

SEC828Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

SEC828Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

SEC828Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

SEC828Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit

4-SEC828Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tripeptidyl Peptidase I elisa. Alternative names of the recognized antigen: CLN2
  • GIG1
  • LPIC
  • Tripeptidyl aminopeptidase
  • Lysosomal pepstatin-insensitive protease
  • Ceroid-Lipofuscinosis, Neuronal 2, Late Infantile
  • Cell growth-inhibitin
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Tripeptidyl Peptidase I ELISA Kit (TPP1)

RK02437 96 Tests
EUR 521

Human Tripeptidyl Peptidase I(TPP1)ELISA Kit

QY-E01705 96T
EUR 361

Tripeptidyl Peptidase I (TPP1) Antibody

20-abx116291
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

20-abx129223
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

20-abx129835
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

abx145299-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

20-abx004302
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

20-abx004789
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

abx029244-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

abx029244-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

20-abx174934
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tripeptidyl Peptidase I (TPP1) Antibody

20-abx334373
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

abx238894-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tripeptidyl Peptidase I (TPP1) Antibody

20-abx178719
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Tripeptidyl Peptidase I (TPP1)

4-RPC828Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O14773
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.2kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Tripeptidyl Peptidase I expressed in: E.coli

Recombinant Tripeptidyl Peptidase I (TPP1)

4-RPC828Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O89023
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.2kDa
  • Isoelectric Point: 5.9
Description: Recombinant Mouse Tripeptidyl Peptidase I expressed in: E.coli

Human Tripeptidyl Peptidase I (TPP1) Protein

20-abx166794
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pig Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx360652-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx363635-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx364262-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

20-abx154796
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Monkey Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx358877-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx355837-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

SEC828Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tripeptidyl Peptidase I (TPP1) in Tissue homogenates and other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

SEC828Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tripeptidyl Peptidase I (TPP1) in Tissue homogenates and other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

SEC828Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tripeptidyl Peptidase I (TPP1) in Tissue homogenates and other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

SEC828Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tripeptidyl Peptidase I (TPP1) in Tissue homogenates and other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit

4-SEC828Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tripeptidyl Peptidase I elisa. Alternative names of the recognized antigen: CLN2
  • GIG1
  • LPIC
  • Tripeptidyl aminopeptidase
  • Lysosomal pepstatin-insensitive protease
  • Ceroid-Lipofuscinosis, Neuronal 2, Late Infantile
  • Cell growth-inhibitin
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Tripeptidyl Peptidase I (TPP1) CLIA Kit

20-abx493920
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Tripeptidyl Peptidase I (TPP1) CLIA Kit

abx197847-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Human TPP1 (Tripeptidyl Peptidase I)

ELK3828 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tripeptidyl Peptidase I (TPP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tri
  • Show more
Description: A sandwich ELISA kit for detection of Tripeptidyl Peptidase I from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) Protein

20-abx167349
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tripeptidyl Peptidase I (TPP1) Antibody (HRP)

20-abx338092
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody (FITC)

20-abx338093
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody (Biotin)

20-abx338094
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Tripeptidyl Peptidase I (TPP1) CLIA Kit

20-abx493921
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse TPP1 (Tripeptidyl Peptidase I)

ELK6821 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tripeptidyl Peptidase I (TPP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tri
  • Show more
Description: A sandwich ELISA kit for detection of Tripeptidyl Peptidase I from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Tripeptidyl Peptidase I (TPP1) ELISA Kit

abx357276-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human)

4-PAC828Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1)

CLIA kit for Human TPP1 (Tripeptidyl Peptidase I)

E-CL-H0954 1 plate of 96 wells
EUR 584
  • Gentaur's TPP1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human TPP1 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human TPP1 (Tripeptidyl Peptidase I) in samples from Serum, Plasma, Cell supernatant

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse)

4-PAC828Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1)

Recombinant Human Tripeptidyl-Peptidase I/TPP1 (C-6His)

CA36-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human Tripeptidyl-Peptidase I/TPP1 (C-6His)

CA36-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human Tripeptidyl-Peptidase I/TPP1 (C-6His)

CA36-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human Tripeptidyl-Peptidase I/TPP1 (C-6His)

CA36-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), APC

4-PAC828Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), Biotinylated

4-PAC828Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Biotin.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), Cy3

4-PAC828Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Cy3.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), FITC

4-PAC828Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with FITC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), HRP

4-PAC828Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with HRP.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), PE

4-PAC828Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with PE.

Human Tripeptidyl- peptidase 1, TPP1 ELISA KIT

ELI-16982h 96 Tests
EUR 824

Human Tripeptidyl-peptidase 1(TPP1) ELISA kit

CSB-EL024113HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tripeptidyl-peptidase 1(TPP1) ELISA kit

1-CSB-EL024113HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1(TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human TPP1 (Tripeptidyl Peptidase ?)

E-EL-H1479 1 plate of 96 wells
EUR 534
  • Gentaur's TPP1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPP1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TPP1 (Tripeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), APC

4-PAC828Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), Biotinylated

4-PAC828Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Biotin.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), Cy3

4-PAC828Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Cy3.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), FITC

4-PAC828Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with FITC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), HRP

4-PAC828Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with HRP.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), PE

4-PAC828Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with PE.

Bovine Tripeptidyl- peptidase 1, TPP1 ELISA KIT

ELI-40084b 96 Tests
EUR 928

Mouse Tripeptidyl- peptidase 1, Tpp1 ELISA KIT

ELI-40085m 96 Tests
EUR 865

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), APC-Cy7

4-PAC828Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Met1~Pro320)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC-Cy7.

ELISA kit for Human Tripeptidyl-peptidase 1 (TPP1)

KTE60145-48T 48T
EUR 332
  • Tripeptidyl-peptidase 1 is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inac
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tripeptidyl-peptidase 1 (TPP1)

KTE60145-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Tripeptidyl-peptidase 1 is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inac
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tripeptidyl-peptidase 1 (TPP1)

KTE60145-96T 96T
EUR 539
  • Tripeptidyl-peptidase 1 is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inac
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC828Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPP1 (Gly198~Pro562)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC-Cy7.

Human Tripeptidyl- peptidase 2, TPP2 ELISA KIT

ELI-17203h 96 Tests
EUR 824

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit

DLR-TPP2-Hu-48T 48T
EUR 517
  • Should the Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Tripeptidyl-Peptidase 2 (TPP2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit

DLR-TPP2-Hu-96T 96T
EUR 673
  • Should the Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Tripeptidyl-Peptidase 2 (TPP2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit

RDR-TPP2-Hu-48Tests 48 Tests
EUR 544

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit

RDR-TPP2-Hu-96Tests 96 Tests
EUR 756

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit

RD-TPP2-Hu-48Tests 48 Tests
EUR 521

Human Tripeptidyl-Peptidase 2 (TPP2) ELISA Kit

RD-TPP2-Hu-96Tests 96 Tests
EUR 723

Mouse Tripeptidyl- peptidase 2, Tpp2 ELISA KIT

ELI-17186m 96 Tests
EUR 865

Bovine Tripeptidyl- peptidase 2, TPP2 ELISA KIT

ELI-29001b 96 Tests
EUR 928

Tripeptidyl Peptidase Ii (TPP2) Antibody

20-abx116292
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripeptidyl-Peptidase 2 (TPP2) Antibody

20-abx141860
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripeptidyl-Peptidase 1 (CLN2) Antibody

20-abx142275
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripeptidyl-Peptidase 2 (TPP2) Antibody

20-abx004914
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripeptidyl-Peptidase 2 (TPP2) Antibody

20-abx321789
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tripeptidyl-Peptidase 1 (CLN2) Antibody

abx430059-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anti-Tripeptidyl Peptidase II Antibody

A06668 100ul/vial
EUR 442
Description: Rabbit Polyclonal Tripeptidyl Peptidase II Antibody. Validated in WB and tested in Human.

Tpp1/ Rat Tpp1 ELISA Kit

ELI-36485r 96 Tests
EUR 886

TPP1 ELISA KIT|Human

EF003763 96 Tests
EUR 689

Human Pyroglutamyl-Peptidase I (PGPEP1) ELISA Kit

abx382184-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human TPP1 PicoKine ELISA Kit

EK2042 96 wells
EUR 425
Description: For quantitative detection of human TPP1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Kinase Library I

HKIN-I 1 set
EUR 450

Human Drug Detoxication I

HDTX-I 1 set
EUR 548

Canine TPP1 ELISA KIT

ELI-51931d 96 Tests
EUR 928

Human Cytokine Primer Library I

HCA-I 1 set
EUR 450

Pyroglutamyl-Peptidase I (Recombinant)

20-abx073375
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human Colon Cancer Primer Library I

HCCP-I 1 set
EUR 548

Human DNA Repair Primer Library I

HDRL-I 1 set
EUR 548

Human Drug Transporter I Primer Library

HDTP-I 1 set
EUR 548

Human Interferon Type I Signaling Primer Library

HIFN-I 1 set
EUR 548

Human Cancer Driver Gene I Primer Library

HCDG-I 1 set
EUR 645

Pyroglutamyl-Peptidase I (PGPEP1) Antibody

20-abx114934
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pyroglutamyl-Peptidase I (PGPEP1) Antibody

20-abx002653
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Pyroglutamyl-Peptidase I (PGPEP1) Antibody

abx026384-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Pyroglutamyl-Peptidase I (PGPEP1) Antibody

abx026384-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dipeptidyl Peptidase I (DPPI) Antibody

abx018198-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Signal Peptidase I (lepB) Antibody

20-abx300297
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Peptidase I (lepB) Antibody

20-abx300726
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pyroglutamyl-Peptidase I (PGPEP1) Antibody

abx236364-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Mouse Cytokine Primer Library I

MCA-I 1 set
EUR 450

Rat Cytokine Primer Library I

RCA-I 1 set
EUR 548

PGPEP1 Pyroglutamyl-Peptidase I Human Recombinant Protein

PROTQ9NXJ5 Regular: 20ug
EUR 317
Description: PGPEP1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 232 amino acids (1-209) and having a molecular mass of 25.5kDa.;PGPEP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

TPP1 siRNA

20-abx905753
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPP1 siRNA

20-abx937853
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPP1 siRNA

20-abx937854
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPP1 antibody

70R-20940 50 ul
EUR 435
Description: Rabbit polyclonal TPP1 antibody

TPP1 Antibody

ABD7425 100 ug
EUR 438

TPP1 Antibody

32932-100ul 100ul
EUR 252

TPP1 antibody

70R-13534 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal TPP1 antibody

TPP1 Antibody

DF7425 200ul
EUR 304
Description: TPP1 Antibody detects endogenous levels of total TPP1.

TPP1 Antibody

1-CSB-PA024113GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TPP1 Antibody

1-CSB-PA024113LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

anti-TPP1

YF-PA10990 50 ul
EUR 363
Description: Mouse polyclonal to TPP1

anti-TPP1

YF-PA10991 50 ug
EUR 363
Description: Mouse polyclonal to TPP1

anti-TPP1

YF-PA10992 100 ul
EUR 403
Description: Rabbit polyclonal to TPP1

anti-TPP1

YF-PA10993 100 ug
EUR 403
Description: Rabbit polyclonal to TPP1

Mouse DNA Repair Primer Library I

MDRL-I 1 set
EUR 645

Signal Peptidase I (LEPB) Antibody (HRP)

20-abx300298
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Peptidase I (LEPB) Antibody (FITC)

20-abx300299
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Peptidase I (LEPB) Antibody (Biotin)

20-abx300300
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Peptidase I (LEPB) Antibody (HRP)

20-abx300727
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Peptidase I (LEPB) Antibody (FITC)

20-abx300728
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Signal Peptidase I (LEPB) Antibody (Biotin)

20-abx300729
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mycobacterium tuberculosis Signal peptidase I (lepB)

1-CSB-YP604637MVZ
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mycobacterium tuberculosis Signal peptidase I(lepB),partial expressed in Yeast

Escherichia coli Signal peptidase I (lepB)

1-CSB-EP360447ENV
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 43.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Signal peptidase I(lepB),partial expressed in E.coli

Mycobacterium tuberculosis Signal peptidase I (lepB)

1-CSB-EP604637MVZ
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mycobacterium tuberculosis Signal peptidase I(lepB),partial expressed in E.coli

Human TPP1 shRNA Plasmid

20-abx950857
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TPP1 Recombinant Protein (Human)

RP032686 100 ug Ask for price

TPP1 Conjugated Antibody

C32932 100ul
EUR 397

TPP1 cloning plasmid

CSB-CL024113HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1692
  • Sequence: atgggactccaagcctgcctcctagggctctttgccctcatcctctctggcaaatgcagttacagcccggagcccgaccagcggaggacgctgcccccaggctgggtgtccctgggccgtgcggaccctgaggaagagctgagtctcacctttgccctgagacagcagaatgtgg
  • Show more
Description: A cloning plasmid for the TPP1 gene.

anti- TPP1 antibody

FNab08894 100µg
EUR 548.75
  • Immunogen: tripeptidyl peptidase I
  • Uniprot ID: O14773
  • Gene ID: 1200
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against TPP1

TPP1 Polyclonal Antibody

ES11280-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TPP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TPP1 Polyclonal Antibody

ES11280-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TPP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TPP1 Polyclonal Antibody

ABP60740-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPP1 from Human, Mouse, Rat. This TPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90

TPP1 Polyclonal Antibody

ABP60740-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPP1 from Human, Mouse, Rat. This TPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90

TPP1 Polyclonal Antibody

ABP60740-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPP1 from Human, Mouse, Rat. This TPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPP1 protein at amino acid sequence of 10-90

TPP1 Rabbit pAb

A5627-100ul 100 ul
EUR 308

TPP1 Rabbit pAb

A5627-200ul 200 ul
EUR 459

TPP1 Rabbit pAb

A5627-20ul 20 ul
EUR 183

TPP1 Rabbit pAb

A5627-50ul 50 ul
EUR 223

TPP1 Rabbit pAb

A6269-100ul 100 ul
EUR 308

TPP1 Rabbit pAb

A6269-200ul 200 ul
EUR 459

TPP1 Rabbit pAb

A6269-20ul 20 ul Ask for price

TPP1 Rabbit pAb

A6269-50ul 50 ul Ask for price

TPP1 Blocking Peptide

DF7425-BP 1mg
EUR 195

Anti-TPP1 Antibody

PB9899 100ug/vial
EUR 334

Anti-TPP1 antibody

PAab08894 100 ug
EUR 386

pCMV-SPORT6-TPP1

PVT13794 2 ug
EUR 391

Anti-TPP1 antibody

STJ28191 100 µl
EUR 277
Description: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.

Anti-TPP1 antibody

STJ27594 100 µl
EUR 277
Description: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.

Anti-TPP1 antibody

STJ192438 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TPP1

Anti-TPP1 (3B1)

YF-MA10174 100 ug
EUR 363
Description: Mouse monoclonal to TPP1

Human Dipeptidyl Peptidase IV ELISA kit

E01D0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidyl Peptidase IV in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dipeptidyl Peptidase IV ELISA kit

E01D0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidyl Peptidase IV in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dipeptidyl Peptidase IV ELISA kit

E01D0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidyl Peptidase IV in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TPP1(Tripeptidyl Peptidase I) ELISA Kit