Human TNS3(Tensin 3) ELISA Kit
Human Tensin 3 (TNS3) ELISA Kit |
RD-TNS3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Tensin 3 (TNS3) ELISA Kit |
20-abx153250 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Tensin 3 (TNS3) ELISA Kit |
SEF819Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids. |
Human Tensin 3 (TNS3) ELISA Kit |
SEF819Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids. |
Human Tensin 3 (TNS3) ELISA Kit |
SEF819Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids. |
Human Tensin 3 (TNS3) ELISA Kit |
SEF819Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids. |
Human Tensin 3 (TNS3) ELISA Kit |
4-SEF819Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Tensin 3 elisa. Alternative names of the recognized antigen: TENS1
- TEM6
- TPP
- Tumor Endothelial Marker 6
- Tensin-Like SH2 Domain-Containing 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tensin 3 (TNS3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Tensin 3 (TNS3) Antibody |
20-abx116031 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tensin 3 (TNS3) Antibody |
20-abx128302 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Tensin-3 (TNS3) Antibody |
abx145305-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Tensin 3 (TNS3) Antibody |
20-abx174741 |
Abbexa |
|
|
|
Tensin-3 (TNS3) Antibody |
abx238847-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Tensin-3 (TNS3) Antibody |
20-abx321056 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tensin 3 (TNS3) Antibody |
20-abx323142 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Tensin 3 (TNS3) |
4-RPF819Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q68CZ2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 37.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Tensin 3 expressed in: E.coli |
ELISA kit for Human TNS3 (Tensin 3) |
ELK4136 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tensin 3 (TNS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tensin 3 (TNS3). N
- Show more
|
Description: A sandwich ELISA kit for detection of Tensin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Tensin-3 (TNS3) |
KTE60173-48T |
Abbkine |
48T |
EUR 332 |
- Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tensin-3 (TNS3) |
KTE60173-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tensin-3 (TNS3) |
KTE60173-96T |
Abbkine |
96T |
EUR 539 |
- Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Tensin 3 (TNS3) CLIA Kit |
20-abx495009 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Tensin 3 (TNS3) Protein |
20-abx166762 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse Tensin-3 (TNS3) |
KTE70085-48T |
Abbkine |
48T |
EUR 332 |
- Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tensin-3 (TNS3) |
KTE70085-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tensin-3 (TNS3) |
KTE70085-96T |
Abbkine |
96T |
EUR 539 |
- Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Tensin 3 (TNS3) Polyclonal Antibody (Human) |
4-PAF819Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNS3 (Met1~Thr301)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3) |
Tensin 3 (TNS3) Polyclonal Antibody (Human), APC |
4-PAF819Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNS3 (Met1~Thr301)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with APC. |
Tensin 3 (TNS3) Polyclonal Antibody (Human), Biotinylated |
4-PAF819Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNS3 (Met1~Thr301)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with Biotin. |
Tensin 3 (TNS3) Polyclonal Antibody (Human), Cy3 |
4-PAF819Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNS3 (Met1~Thr301)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with Cy3. |
Tensin 3 (TNS3) Polyclonal Antibody (Human), FITC |
4-PAF819Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNS3 (Met1~Thr301)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with FITC. |
Tensin 3 (TNS3) Polyclonal Antibody (Human), HRP |
4-PAF819Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNS3 (Met1~Thr301)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with HRP. |
Tensin 3 (TNS3) Polyclonal Antibody (Human), PE |
4-PAF819Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNS3 (Met1~Thr301)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with PE. |
Tensin 3 (TNS3) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF819Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TNS3 (Met1~Thr301)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with APC-Cy7. |
Human Tensin-1(TNS1) ELISA kit |
CSB-EL024032HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Tensin-1 (TNS1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Tensin-1(TNS1) ELISA kit |
1-CSB-EL024032HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Tensin-1(TNS1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Tensin-1 (TNS1) ELISA Kit |
abx383857-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Tensin-4 (TNS4) ELISA Kit |
abx383859-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
TNS3 antibody |
70R-20911 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TNS3 antibody |
TNS3 Antibody |
1-CSB-PA050061 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
TNS3 Antibody |
1-CSB-PA731561ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
TNS3 Antibody |
1-CSB-PA024033GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
TNS3 siRNA |
20-abx937705 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TNS3 siRNA |
20-abx937706 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human TNS3 shRNA Plasmid |
20-abx962067 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-Tensin 3 Antibody |
A1168-100 |
Biovision |
|
EUR 370 |
Tensin-3 (TENS3) Antibody |
20-abx219047 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Human Tensin-4 (TNS4) |
KTE60172-48T |
Abbkine |
48T |
EUR 332 |
- CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tensin-4 (TNS4) |
KTE60172-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tensin-4 (TNS4) |
KTE60172-96T |
Abbkine |
96T |
EUR 539 |
- CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tensin-1 (TNS1) |
KTE60174-48T |
Abbkine |
48T |
EUR 332 |
- Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tensin-1 (TNS1) |
KTE60174-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tensin-1 (TNS1) |
KTE60174-96T |
Abbkine |
96T |
EUR 539 |
- Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
TNS3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2421704 |
ABM |
1.0 ug DNA |
EUR 154 |
TNS3 Polyclonal Antibody |
31406-100ul |
SAB |
100ul |
EUR 252 |
TNS3 Polyclonal Antibody |
31406-50ul |
SAB |
50ul |
EUR 187 |
TNS3 cloning plasmid |
CSB-CL731561HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 753
- Sequence: atggaggagggccatgggctggacctcacttacatcacggagcgcatcatcgctgtgtccttccctgccggctgctctgaggagtcctacctgcacaacctacaggaggtcacgcgcatgctcaagtccaagcacggggacaactacctggtattaaacctttcagaaaagagata
- Show more
|
Description: A cloning plasmid for the TNS3 gene. |
TNS3 Rabbit pAb |
A7991-100ul |
Abclonal |
100 ul |
EUR 308 |
TNS3 Rabbit pAb |
A7991-200ul |
Abclonal |
200 ul |
EUR 459 |
TNS3 Rabbit pAb |
A7991-20ul |
Abclonal |
20 ul |
EUR 183 |
TNS3 Rabbit pAb |
A7991-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- TNS3 antibody |
FNab08847 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: tensin 3
- Uniprot ID: Q68CZ2
- Gene ID: 64759
- Research Area: Cancer, Signal Transduction, Metabolism
|
Description: Antibody raised against TNS3 |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
DLR-PTEN-Hu-48T |
DL Develop |
48T |
EUR 441 |
- Should the Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
DLR-PTEN-Hu-96T |
DL Develop |
96T |
EUR 570 |
- Should the Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
20-abx152881 |
Abbexa |
-
EUR 6173.00
-
EUR 3291.00
-
EUR 770.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
abx250957-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Phosphatase And Tensin Homolog ELISA Kit (PTEN) |
RK02152 |
Abclonal |
96 Tests |
EUR 521 |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
RDR-PTEN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 455 |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
RDR-PTEN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 629 |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
RD-PTEN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 436 |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
RD-PTEN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 601 |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
SEF822Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 3815.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
SEF822Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 401.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
SEF822Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 531.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
SEF822Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2090.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit |
4-SEF822Hu |
Cloud-Clone |
-
EUR 3866.00
-
EUR 2041.00
-
EUR 532.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Phosphatase And Tensin Homolog elisa. Alternative names of the recognized antigen: BZS
- MHAM
- MMAC1
- PTEN1
- TEP1
- Mutated In Multiple Advanced Cancers 1
- Phosphatidylinositol 3, 4, 5-trisphosphate 3-phosphatase and dual-specificity prot
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
TNS3 ORF Vector (Human) (pORF) |
ORF010839 |
ABM |
1.0 ug DNA |
EUR 95 |
FSH (Human Follicle-stimulating hormone) ELISA test |
3 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone) |
ELISA kit for Rat Tensin-4 (TNS4) |
KTE100052-48T |
Abbkine |
48T |
EUR 332 |
- CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Tensin-4 (TNS4) |
KTE100052-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Tensin-4 (TNS4) |
KTE100052-96T |
Abbkine |
96T |
EUR 539 |
- CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Tensin-4 (TNS4) |
KTE10015-48T |
Abbkine |
48T |
EUR 354 |
- Tensin-4 (TNS4) may be involved in cell migration, cartilage development and in linking signal transduction pathways to the cytoskeleton and may promote apoptosis, via its cleavage by caspase-3.
|
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Tensin-4 (TNS4) |
KTE10015-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Tensin-4 (TNS4) may be involved in cell migration, cartilage development and in linking signal transduction pathways to the cytoskeleton and may promote apoptosis, via its cleavage by caspase-3.
|
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Tensin-4 (TNS4) |
KTE10015-96T |
Abbkine |
96T |
EUR 572 |
- Tensin-4 (TNS4) may be involved in cell migration, cartilage development and in linking signal transduction pathways to the cytoskeleton and may promote apoptosis, via its cleavage by caspase-3.
|
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Tensin-1 (TNS1) |
KTE10016-48T |
Abbkine |
48T |
EUR 354 |
- Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Tensin-1 (TNS1) |
KTE10016-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Tensin-1 (TNS1) |
KTE10016-96T |
Abbkine |
96T |
EUR 572 |
- Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tensin-4 (TNS4) |
KTE70084-48T |
Abbkine |
48T |
EUR 332 |
- CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tensin-4 (TNS4) |
KTE70084-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tensin-4 (TNS4) |
KTE70084-96T |
Abbkine |
96T |
EUR 539 |
- CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human PTEN (Phosphatase And Tensin Homolog) |
ELK1367 |
ELK Biotech |
1 plate of 96 wells |
EUR 372 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phosphatase And Tensin Homolog (PTEN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Phosphatase And Tensin Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Phosphatase and tensin homolog (PTEN) |
KTE62888-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Human Phosphatase and tensin homolog (PTEN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Phosphatase and tensin homolog (PTEN) |
KTE62888-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Human Phosphatase and tensin homolog (PTEN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Phosphatase and tensin homolog (PTEN) |
KTE62888-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Human Phosphatase and tensin homolog (PTEN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Transmembrane Phosphoinositide 3-Phosphatase And Tensin Homolog 2 (TPTE2) ELISA Kit |
abx383888-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
TNS3 Polyclonal Conjugated Antibody |
C31406 |
SAB |
100ul |
EUR 397 |
Mouse TNS3 shRNA Plasmid |
20-abx983333 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Tns3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4967904 |
ABM |
1.0 ug DNA |
EUR 154 |
Tns3 3'UTR Luciferase Stable Cell Line |
TU120936 |
ABM |
1.0 ml |
Ask for price |
Tns3 3'UTR GFP Stable Cell Line |
TU170936 |
ABM |
1.0 ml |
Ask for price |
TNS3 3'UTR GFP Stable Cell Line |
TU076078 |
ABM |
1.0 ml |
EUR 4617 |
TNS3 3'UTR Luciferase Stable Cell Line |
TU026078 |
ABM |
1.0 ml |
EUR 4617 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
TNS3 sgRNA CRISPR Lentivector set (Human) |
K2421701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tensin-1 Antibody |
45400-100ul |
SAB |
100ul |
EUR 252 |
Tensin-1 Antibody |
45400-50ul |
SAB |
50ul |
EUR 187 |
Tensin-2 Antibody |
45401-100ul |
SAB |
100ul |
EUR 252 |
Tensin-2 Antibody |
45401-50ul |
SAB |
50ul |
EUR 187 |
Tensin-1 Antibody |
DF8622 |
Affbiotech |
200ul |
EUR 304 |
Description: Tensin-1 Antibody detects endogenous levels of total Tensin-1. |
Tensin-2 Antibody |
DF8623 |
Affbiotech |
200ul |
EUR 304 |
Description: Tensin-2 Antibody detects endogenous levels of total Tensin-2. |
Tensin 1 antibody |
70R-50500 |
Fitzgerald |
100 ul |
EUR 287 |
Description: Purified Polyclonal Tensin 1 antibody |
anti-Tensin 1 |
YF-PA15082 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Tensin 1 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Dr. P Kit-Solution 3 |
K2021010-3 |
Biochain |
50 ml |
EUR 133 |
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Human Tensin 1 (TNS1) Protein |
20-abx650188 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1887.00
-
EUR 746.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
PTEN ELISA Kit| Rat Phosphatase and Tensin Homolog ELISA Kit |
EF018003 |
Lifescience Market |
96 Tests |
EUR 689 |
Human TNS3(Tensin 3) ELISA Kit