Human TNS3(Tensin 3) ELISA Kit

Human TNS3(Tensin 3) ELISA Kit

Human Tensin 3 (TNS3) ELISA Kit

RD-TNS3-Hu-96Tests 96 Tests
EUR 723

Human Tensin 3 (TNS3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tensin- 3, TNS3 ELISA KIT

ELI-16205h 96 Tests
EUR 824

Human Tensin 3(TNS3)ELISA Kit

QY-E00275 96T
EUR 361

Human Tensin 3 (TNS3) ELISA Kit

SEF819Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tensin 3 (TNS3) ELISA Kit

SEF819Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tensin 3 (TNS3) ELISA Kit

SEF819Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tensin 3 (TNS3) ELISA Kit

SEF819Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tensin 3 (TNS3) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tensin 3 elisa. Alternative names of the recognized antigen: TENS1
  • TEM6
  • TPP
  • Tumor Endothelial Marker 6
  • Tensin-Like SH2 Domain-Containing 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tensin 3 (TNS3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Tensin- 3, Tns3 ELISA KIT

ELI-46578m 96 Tests
EUR 865

Tensin 3 (TNS3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tensin 3 (TNS3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tensin-3 (TNS3) Antibody

abx145305-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tensin 3 (TNS3) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tensin-3 (TNS3) Antibody

abx238847-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tensin-3 (TNS3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tensin 3 (TNS3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Tensin 3 (TNS3)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q68CZ2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Tensin 3 expressed in: E.coli

ELISA kit for Human TNS3 (Tensin 3)

ELK4136 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tensin 3 (TNS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tensin 3 (TNS3). N
  • Show more
Description: A sandwich ELISA kit for detection of Tensin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Tensin-3 (TNS3)

KTE60173-48T 48T
EUR 332
  • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-3 (TNS3)

KTE60173-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-3 (TNS3)

KTE60173-96T 96T
EUR 539
  • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Tensin 3 (TNS3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Tensin 3 (TNS3) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse Tensin-3 (TNS3)

KTE70085-48T 48T
EUR 332
  • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tensin-3 (TNS3)

KTE70085-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tensin-3 (TNS3)

KTE70085-96T 96T
EUR 539
  • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tensin 3 (TNS3) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNS3 (Met1~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3)

Tensin 3 (TNS3) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNS3 (Met1~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with APC.

Tensin 3 (TNS3) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNS3 (Met1~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with Biotin.

Tensin 3 (TNS3) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNS3 (Met1~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with Cy3.

Tensin 3 (TNS3) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNS3 (Met1~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with FITC.

Tensin 3 (TNS3) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNS3 (Met1~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with HRP.

Tensin 3 (TNS3) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNS3 (Met1~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with PE.

Tensin 3 (TNS3) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNS3 (Met1~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with APC-Cy7.


EF003729 96 Tests
EUR 689

TNS3 ELISA Kit (Human) (OKCD00479)

OKCD00479 96 Wells
EUR 831
Description: Description of target: May play a role in actin remodeling. Involved in the dissociation of the integrin-tensin-actin complex. EGF activates TNS4 and down-regulates TNS3 which results in capping the tail of ITGB1. Seems to be involved in mammary cell migration. May be involved in cell migration and bone development (By similarity).By similarity1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"A reciprocal tensin-3-cten switch mediates EGF-driven mammary cell migration."_x005F_x005F_x000D_Katz M., Amit I., Citri A., Shay T., Carvalho S., Lavi S., Milanezi F., Lyass L., Amariglio N., Jacob-Hirsch J., Ben-Chetrit N., Tarcic G., Lindzen M., Avraham R., Liao Y.C., Trusk P., Lyass A., Rechavi G. , Spector N.L., Lo S.H., Schmitt F., Bacus S.S., Yarden Y._x005F_x005F_x000D_Nat. Cell Biol. 9:961-969(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INDUCTION, KNOCKDOWN IN MCF10A CELLS. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.052 ng/mL

TNS3 ELISA Kit (Human) (OKDD00570)

OKDD00570 96 Wells
EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.061 ng/mL

Human Tensin-1(TNS1) ELISA kit

CSB-EL024032HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tensin-1 (TNS1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tensin-1(TNS1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tensin-1(TNS1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tensin- 4, TNS4 ELISA KIT

ELI-16206h 96 Tests
EUR 824

Human Tensin-1 (TNS1) ELISA Kit

abx383857-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Tensin-4 (TNS4) ELISA Kit

abx383859-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Tensin- 1, TNS1 ELISA KIT

ELI-40018h 96 Tests
EUR 824

Human Tensin 4(TNS4)ELISA Kit

QY-E00274 96T
EUR 361

Human Tensin 2(TNS2)ELISA Kit

QY-E00276 96T
EUR 361

Human Tensin 1(TNS1)ELISA Kit

QY-E00277 96T
EUR 361

TNS3 antibody

70R-20911 50 ul
EUR 435
Description: Rabbit polyclonal TNS3 antibody

TNS3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

TNS3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TNS3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Chicken Tensin, TNS ELISA KIT

ELI-46577c 96 Tests
EUR 928

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Anti-Tensin 3 Antibody

EUR 370

Tensin-3 (TENS3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human TNS3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ELISA kit for Human Tensin-4 (TNS4)

KTE60172-48T 48T
EUR 332
  • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-4 (TNS4)

KTE60172-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-4 (TNS4)

KTE60172-96T 96T
EUR 539
  • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-1 (TNS1)

KTE60174-48T 48T
EUR 332
  • Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-1 (TNS1)

KTE60174-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-1 (TNS1)

KTE60174-96T 96T
EUR 539
  • Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TNS3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2421704 1.0 ug DNA
EUR 154

TNS3 Polyclonal Antibody

31406-100ul 100ul
EUR 252

TNS3 Polyclonal Antibody

31406-50ul 50ul
EUR 187

TNS3 cloning plasmid

CSB-CL731561HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 753
  • Sequence: atggaggagggccatgggctggacctcacttacatcacggagcgcatcatcgctgtgtccttccctgccggctgctctgaggagtcctacctgcacaacctacaggaggtcacgcgcatgctcaagtccaagcacggggacaactacctggtattaaacctttcagaaaagagata
  • Show more
Description: A cloning plasmid for the TNS3 gene.

TNS3 Rabbit pAb

A7991-100ul 100 ul
EUR 308

TNS3 Rabbit pAb

A7991-200ul 200 ul
EUR 459

TNS3 Rabbit pAb

A7991-20ul 20 ul
EUR 183

TNS3 Rabbit pAb

A7991-50ul 50 ul
EUR 223

anti- TNS3 antibody

FNab08847 100µg
EUR 548.75
  • Immunogen: tensin 3
  • Uniprot ID: Q68CZ2
  • Gene ID: 64759
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against TNS3

Anti-TNS3 antibody

PAab08847 100 ug
EUR 386

Anti-TNS3 antibody

STJ117844 100 µl
EUR 277

Bovine Tensin- 1, TNS1 ELISA KIT

ELI-29174b 96 Tests
EUR 928

Bovine Tensin- 4, TNS4 ELISA KIT

ELI-52065b 96 Tests
EUR 928

Mouse Tensin- 4, Tns4 ELISA KIT

ELI-46579m 96 Tests
EUR 865

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

EUR 441
  • Should the Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

EUR 570
  • Should the Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

  • EUR 6173.00
  • EUR 3291.00
  • EUR 770.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

abx250957-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Phosphatase And Tensin Homolog ELISA Kit (PTEN)

RK02152 96 Tests
EUR 521

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

RDR-PTEN-Hu-48Tests 48 Tests
EUR 455

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

RDR-PTEN-Hu-96Tests 96 Tests
EUR 629

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

RD-PTEN-Hu-48Tests 48 Tests
EUR 436

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

RD-PTEN-Hu-96Tests 96 Tests
EUR 601

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

SEF822Hu-10x96wellstestplate 10x96-wells test plate
EUR 3815.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

SEF822Hu-1x48wellstestplate 1x48-wells test plate
EUR 401.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

SEF822Hu-1x96wellstestplate 1x96-wells test plate
EUR 531.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

SEF822Hu-5x96wellstestplate 5x96-wells test plate
EUR 2090.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit

  • EUR 3866.00
  • EUR 2041.00
  • EUR 532.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phosphatase And Tensin Homolog elisa. Alternative names of the recognized antigen: BZS
  • MHAM
  • MMAC1
  • PTEN1
  • TEP1
  • Mutated In Multiple Advanced Cancers 1
  • Phosphatidylinositol 3, 4, 5-trisphosphate 3-phosphatase and dual-specificity prot
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

TNS3 ORF Vector (Human) (pORF)

ORF010839 1.0 ug DNA
EUR 95

FSH (Human Follicle-stimulating hormone) ELISA test

3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

ELISA kit for Rat Tensin-4 (TNS4)

KTE100052-48T 48T
EUR 332
  • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Tensin-4 (TNS4)

KTE100052-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Tensin-4 (TNS4)

KTE100052-96T 96T
EUR 539
  • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-4 (TNS4)

KTE10015-48T 48T
EUR 354
  • Tensin-4 (TNS4) may be involved in cell migration, cartilage development and in linking signal transduction pathways to the cytoskeleton and may promote apoptosis, via its cleavage by caspase-3.
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-4 (TNS4)

KTE10015-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Tensin-4 (TNS4) may be involved in cell migration, cartilage development and in linking signal transduction pathways to the cytoskeleton and may promote apoptosis, via its cleavage by caspase-3.
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-4 (TNS4)

KTE10015-96T 96T
EUR 572
  • Tensin-4 (TNS4) may be involved in cell migration, cartilage development and in linking signal transduction pathways to the cytoskeleton and may promote apoptosis, via its cleavage by caspase-3.
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-1 (TNS1)

KTE10016-48T 48T
EUR 354
  • Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-1 (TNS1)

KTE10016-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-1 (TNS1)

KTE10016-96T 96T
EUR 572
  • Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tensin-4 (TNS4)

KTE70084-48T 48T
EUR 332
  • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tensin-4 (TNS4)

KTE70084-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tensin-4 (TNS4)

KTE70084-96T 96T
EUR 539
  • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TNS3 Polyclonal Conjugated Antibody

C31406 100ul
EUR 397

Mouse TNS3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ELISA kit for Human PTEN (Phosphatase And Tensin Homolog)

ELK1367 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phosphatase And Tensin Homolog (PTEN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phosphatase And Tensin Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Phosphatase and tensin homolog (PTEN)

KTE62888-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Phosphatase and tensin homolog (PTEN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatase and tensin homolog (PTEN)

KTE62888-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Phosphatase and tensin homolog (PTEN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatase and tensin homolog (PTEN)

KTE62888-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Phosphatase and tensin homolog (PTEN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Transmembrane Phosphoinositide 3-Phosphatase And Tensin Homolog 2 (TPTE2) ELISA Kit

abx383888-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Tns3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4967904 1.0 ug DNA
EUR 154

Tns3 3'UTR Luciferase Stable Cell Line

TU120936 1.0 ml Ask for price

Tns3 3'UTR GFP Stable Cell Line

TU170936 1.0 ml Ask for price

TNS3 3'UTR GFP Stable Cell Line

TU076078 1.0 ml
EUR 4617

TNS3 3'UTR Luciferase Stable Cell Line

TU026078 1.0 ml
EUR 4617

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

TNS3 sgRNA CRISPR Lentivector set (Human)

K2421701 3 x 1.0 ug
EUR 339

Tensin-1 Antibody

45400-100ul 100ul
EUR 252

Tensin-1 Antibody

45400-50ul 50ul
EUR 187

Tensin-2 Antibody

45401-100ul 100ul
EUR 252

Tensin-2 Antibody

45401-50ul 50ul
EUR 187

Tensin-1 Antibody

DF8622 200ul
EUR 304
Description: Tensin-1 Antibody detects endogenous levels of total Tensin-1.

Tensin-2 Antibody

DF8623 200ul
EUR 304
Description: Tensin-2 Antibody detects endogenous levels of total Tensin-2.

Tensin 1 antibody

70R-50500 100 ul
EUR 287
Description: Purified Polyclonal Tensin 1 antibody

Tensin- 1 Antibody

ABD8622 100 ug
EUR 438

Tensin- 2 Antibody

ABD8623 100 ug
EUR 438

anti-Tensin 1

YF-PA15082 50 ug
EUR 363
Description: Mouse polyclonal to Tensin 1

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Tensin 1 (TNS1) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1887.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dr. P Kit-Solution 3

K2021010-3 50 ml
EUR 133
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Human TNS3(Tensin 3) ELISA Kit