Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit |
RD-TGOLN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Trans Golgi Network Protein 2 (TGOLN2) Antibody |
20-abx124522 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Trans-Golgi Network Protein 2 (TGOLN2) Antibody |
20-abx116194 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Trans Golgi Network Protein 2 (TGOLN2) Antibody |
20-abx131635 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Trans Golgi Network Protein 2 (TGOLN2) Antibody |
abx034174-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Trans Golgi Network Protein 2 (TGOLN2) Antibody |
abx034174-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Trans Golgi Network Protein 2 (TGOLN2) Antibody |
20-abx174855 |
Abbexa |
|
|
|
Recombinant Trans Golgi NeTwork Protein 2 (TGOLN2) |
4-RPH035Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O43493
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Trans Golgi NeTwork Protein 2 expressed in: E.coli |
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit |
20-abx153277 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit |
abx257683-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit |
SEH035Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit |
SEH035Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit |
SEH035Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit |
SEH035Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit |
4-SEH035Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Trans Golgi Network Protein 2 elisa. Alternative names of the recognized antigen: TGN51
- TGN46
- TGN48
- TGN38
- TTGN2
- Trans-Golgi Network Protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Trans Golgi Network Protein 2 (TGOLN2) Protein |
20-abx650705 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Trans Golgi Network Protein 2 (TGOLN2) CLIA Kit |
20-abx495361 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human TGOLN2 (Trans Golgi Network Protein 2) |
ELK3891 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Trans Golgi Network Protein 2 (TGOLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
- Show more
|
Description: A sandwich ELISA kit for detection of Trans Golgi Network Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human) |
4-PAH035Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2) |
Human TGOLN2
(Trans-Golgi network integral membrane protein 2) ELISA Kit |
EH4979 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: O43493
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), APC |
4-PAH035Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with APC. |
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), Biotinylated |
4-PAH035Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with Biotin. |
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), Cy3 |
4-PAH035Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with Cy3. |
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), FITC |
4-PAH035Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with FITC. |
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), HRP |
4-PAH035Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with HRP. |
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), PE |
4-PAH035Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with PE. |
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAH035Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with APC-Cy7. |
Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody |
abx411988-01ml |
Abbexa |
0.1 ml |
EUR 704 |
|
Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody |
abx412473-01ml |
Abbexa |
0.1 ml |
EUR 704 |
|
Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody |
abx412474-25ug |
Abbexa |
25 ug |
EUR 1121 |
|
Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody |
abx412475-10ug |
Abbexa |
10 ug |
EUR 606 |
|
Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody |
abx238653-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody |
abx411994-01ml |
Abbexa |
0.1 ml |
EUR 704 |
|
Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody |
abx412471-01ml |
Abbexa |
0.1 ml |
EUR 801 |
|
Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody |
abx412472-25ug |
Abbexa |
25 ug |
EUR 801 |
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
TGOLN2 Recombinant Protein (Human) |
RP031417 |
ABM |
100 ug |
Ask for price |
TGOLN2 Recombinant Protein (Human) |
RP031420 |
ABM |
100 ug |
Ask for price |
Human Golgi Protein 73 ELISA kit |
E01G0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Golgi Protein 73 ELISA kit |
E01G0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Golgi Protein 73 ELISA kit |
E01G0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Golgi reassembly- stacking protein 2, GORASP2 ELISA KIT |
ELI-39015h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Golgi Reassembly Stacking Protein 2 (GORASP2) ELISA Kit |
abx387624-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
TGOLN2 siRNA |
20-abx936650 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TGOLN2 siRNA |
20-abx936651 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TGOLN2 antibody |
70R-21719 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TGOLN2 antibody |
TGOLN2 antibody |
70R-7394 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TGOLN2 antibody raised against the N terminal of TGOLN2 |
TGOLN2 Antibody |
1-CSB-PA023468GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TGOLN2. Recognizes TGOLN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Human ERGIC And Golgi 2 (ERGIC2) ELISA Kit |
abx387183-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Golgi Protein 73 (GP73) ELISA Kit |
20-abx151704 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Golgi Protein 73 (GP73) ELISA Kit |
abx052512-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Golgi Protein 73 (GP73) ELISA Kit |
abx252562-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Golgi Protein 73 (GP73) ELISA Kit |
DLR-GP73-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Golgi Protein 73 (GP73) ELISA Kit |
DLR-GP73-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Golgi Protein 73 (GP73) ELISA Kit |
SEB668Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids. |
Human Golgi Protein 73 (GP73) ELISA Kit |
SEB668Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids. |
Human Golgi Protein 73 (GP73) ELISA Kit |
SEB668Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids. |
Human Golgi Protein 73 (GP73) ELISA Kit |
SEB668Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids. |
Human Golgi Protein 73 (GP73) ELISA Kit |
4-SEB668Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
- GOLPH2
- C9orf155
- Golgi Membrane Protein 1
- Golgi Phosphoprotein 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Golgi Protein 73 ELISA Kit (GP73) |
RK01490 |
Abclonal |
96 Tests |
EUR 521 |
Human Golgi Protein 73 (GP73) ELISA Kit |
RD-GP73-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Golgi Protein 73 (GP73) ELISA Kit |
RD-GP73-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Golgi Protein 73 (GP73) ELISA Kit |
RDR-GP73-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Golgi Protein 73 (GP73) ELISA Kit |
RDR-GP73-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
TGOLN2 Recombinant Protein (Mouse) |
RP178508 |
ABM |
100 ug |
Ask for price |
TGOLN2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2366803 |
ABM |
1.0 ug DNA |
EUR 154 |
Human TGOLN2 shRNA Plasmid |
20-abx957231 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse Golgi reassembly- stacking protein 2, Gorasp2 ELISA KIT |
ELI-27852m |
Lifescience Market |
96 Tests |
EUR 865 |
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Goat Golgi Protein 73 ELISA kit |
E06G0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Golgi Protein 73 ELISA kit |
E06G0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Golgi Protein 73 ELISA kit |
E06G0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Golgi Protein 73 ELISA kit |
E02G0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Golgi Protein 73 ELISA kit |
E02G0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Golgi Protein 73 ELISA kit |
E02G0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Golgi Protein 73 ELISA kit |
E03G0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Golgi Protein 73 ELISA kit |
E03G0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Golgi Protein 73 ELISA kit |
E03G0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Golgi Protein 73 ELISA kit |
E04G0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Golgi Protein 73 ELISA kit |
E04G0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Golgi Protein 73 ELISA kit |
E04G0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Golgi Protein 73 ELISA kit |
E08G0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Golgi Protein 73 ELISA kit |
E08G0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Golgi Protein 73 ELISA kit |
E08G0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Golgi Protein 73 ELISA kit |
E07G0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Golgi Protein 73 ELISA kit |
E07G0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Golgi Protein 73 ELISA kit |
E07G0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Golgi Protein 73 ELISA kit |
E09G0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Golgi Protein 73 ELISA kit |
E09G0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Golgi Protein 73 ELISA kit |
E09G0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Golgi Apparatus Protein 1 (GLG1) ELISA Kit |
abx555387-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 1-3 weeks.
|
ELISA kit for Human Golgi apparatus protein 1 |
EK3366 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi apparatus protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Golgi membrane protein 1 |
EK3857 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi membrane protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human GLG1/ Golgi apparatus protein 1 ELISA Kit |
E1014Hu |
Sunlong |
1 Kit |
EUR 605 |
Human GOLM1/ Golgi membrane protein 1 ELISA Kit |
E1032Hu |
Sunlong |
1 Kit |
EUR 571 |
Human GP-73(Golgi Protein 73) ELISA Kit |
EH3162 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.625-40 ng/ml
- Alias: GP-73
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml |
Human Golgi resident protein GCP60, ACBD3 ELISA KIT |
ELI-12528h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Golgi membrane protein 1, GOLM1 ELISA KIT |
ELI-05457h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human GP73 (Golgi Protein 73) |
ELK2140 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Golgi Protein 73 (GP73). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Golgi Prot
- Show more
|
Description: A sandwich ELISA kit for detection of Golgi Protein 73 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human golgi protein 73(GP-73)ELISA Kit |
GA-E1449HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human golgi protein 73(GP-73)ELISA Kit |
GA-E1449HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Golgi apparatus protein 1, GLG1 ELISA KIT |
ELI-39078h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Golgi Membrane Protein 1 (GOLM1) ELISA Kit |
abx251193-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human golgi protein 73,GP-73 ELISA Kit |
201-12-1433 |
SunredBio |
96 tests |
EUR 440 |
- This golgi protein 73 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human golgi protein 73, GP-73 ELISA Kit |
CSB-E11332h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human golgi protein 73, GP-73 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human golgi protein 73, GP-73 ELISA Kit |
1-CSB-E11332h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human golgi protein 73, GP-73 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
TGOLN2 cloning plasmid |
CSB-CL023468HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1344
- Sequence: atgcggttcgtggttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagaagctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccgg
- Show more
|
Description: A cloning plasmid for the TGOLN2 gene. |
TGOLN2 cloning plasmid |
CSB-CL023468HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1314
- Sequence: atgcggttcgtagttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagatgctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccgg
- Show more
|
Description: A cloning plasmid for the TGOLN2 gene. |
TGOLN2 Rabbit pAb |
A16707-100ul |
Abclonal |
100 ul |
EUR 308 |
TGOLN2 Rabbit pAb |
A16707-200ul |
Abclonal |
200 ul |
EUR 459 |
TGOLN2 Rabbit pAb |
A16707-20ul |
Abclonal |
20 ul |
EUR 183 |
TGOLN2 Rabbit pAb |
A16707-50ul |
Abclonal |
50 ul |
EUR 223 |
TGOLN2 Rabbit pAb |
A8914-100ul |
Abclonal |
100 ul |
EUR 308 |
TGOLN2 Rabbit pAb |
A8914-200ul |
Abclonal |
200 ul |
EUR 459 |
TGOLN2 Rabbit pAb |
A8914-20ul |
Abclonal |
20 ul |
Ask for price |
TGOLN2 Rabbit pAb |
A8914-50ul |
Abclonal |
50 ul |
Ask for price |
TGOLN2 Blocking Peptide |
33R-7348 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGOLN2 antibody, catalog no. 70R-7394 |
TGOLN2 Polyclonal Antibody |
29941-100ul |
SAB |
100ul |
EUR 252 |
TGOLN2 Polyclonal Antibody |
29941-50ul |
SAB |
50ul |
EUR 187 |
Anti-TGOLN2 antibody |
STJ111478 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a type I integral membrane protein that is localized to the trans-Golgi network, a major sorting station for secretory and membrane proteins. The encoded protein cycles between early endosomes and the trans-Golgi network, and may play a role in exocytic vesicle formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Mouse ERGIC And Golgi 2 (ERGIC2) ELISA Kit |
abx389190-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
TGOLN2 ORF Vector (Human) (pORF) |
ORF010473 |
ABM |
1.0 ug DNA |
EUR 95 |
TGOLN2 ORF Vector (Human) (pORF) |
ORF010474 |
ABM |
1.0 ug DNA |
EUR 95 |
Trans-2-aminocyclohexanol hydrochloride |
20-abx184451 |
Abbexa |
-
EUR 217.00
-
EUR 746.00
-
EUR 342.00
|
|
- Shipped within 1-2 weeks.
|
Potassium Trans-2-Methylcyclohexyltrifluoroborate |
abx188856-100g |
Abbexa |
100 g |
EUR 1386 |
- Shipped within 1-2 weeks.
|
Trans-2-Phenylcyclopropylamine hydrochloride |
M55000 |
EpiGentek |
250 mg |
EUR 196.45 |
Description: The best epigenetics products |
Human Peroxisomal trans- 2- enoyl- CoA reductase, PECR ELISA KIT |
ELI-22081h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Peroxisomal trans-2-enoyl-CoA reductase (PECR) ELISA Kit |
abx382149-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit |
E01C1881-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit |
E01C1881-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit |
E01C1881-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Golgi SNAP receptor complex member 2, GOSR2 ELISA KIT |
ELI-27259h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Golgi SNAP Receptor Complex Member 2 (GOSR2) ELISA Kit |
abx259601-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Component Of Oligomeric Golgi Complex 2 (COG2) ELISA Kit |
abx384724-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
TGOLN2 Protein Vector (Human) (pPB-C-His) |
PV041889 |
ABM |
500 ng |
EUR 329 |
TGOLN2 Protein Vector (Human) (pPB-N-His) |
PV041890 |
ABM |
500 ng |
EUR 329 |
TGOLN2 Protein Vector (Human) (pPM-C-HA) |
PV041891 |
ABM |
500 ng |
EUR 329 |
TGOLN2 Protein Vector (Human) (pPM-C-His) |
PV041892 |
ABM |
500 ng |
EUR 329 |
TGOLN2 Protein Vector (Human) (pPB-C-His) |
PV041893 |
ABM |
500 ng |
EUR 329 |
TGOLN2 Protein Vector (Human) (pPB-N-His) |
PV041894 |
ABM |
500 ng |
EUR 329 |
TGOLN2 Protein Vector (Human) (pPM-C-HA) |
PV041895 |
ABM |
500 ng |
EUR 329 |
TGOLN2 Protein Vector (Human) (pPM-C-His) |
PV041896 |
ABM |
500 ng |
EUR 329 |
Pig Golgi Protein 73 (GP73) ELISA Kit |
abx361254-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Golgi Protein 73 (GP73) ELISA Kit |
abx363412-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Guinea pig Golgi Protein 73 ELISA kit |
E05G0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Golgi Protein 73 ELISA kit |
E05G0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Golgi Protein 73 ELISA kit |
E05G0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
20-abx154099 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Golgi Protein 73 (GP73) ELISA Kit |
20-abx258885 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Chicken Golgi Protein 73 (GP73) ELISA Kit |
abx356107-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Golgi Protein 73 (GP73) ELISA Kit |
abx359502-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Golgi Protein 73 (GP73) ELISA Kit |
DLR-GP73-Mu-48T |
DL Develop |
48T |
EUR 508 |
- Should the Mouse Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
DLR-GP73-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
SEB668Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
SEB668Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
SEB668Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
SEB668Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
4-SEB668Mu |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
- GOLPH2
- C9orf155
- Golgi Membrane Protein 1
- Golgi Phosphoprotein 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Golgi Protein 73 (GP73) ELISA Kit |
SEB668Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4875.49 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Golgi Protein 73 (GP73) ELISA Kit |
SEB668Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 489.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Golgi Protein 73 (GP73) ELISA Kit |
SEB668Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 655.94 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Golgi Protein 73 (GP73) ELISA Kit |
SEB668Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2651.73 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Golgi Protein 73 (GP73) ELISA Kit |
4-SEB668Ra |
Cloud-Clone |
-
EUR 4926.00
-
EUR 2602.00
-
EUR 656.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
- GOLPH2
- C9orf155
- Golgi Membrane Protein 1
- Golgi Phosphoprotein 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Golgi Protein 73 ELISA Kit (GP73) |
RK02859 |
Abclonal |
96 Tests |
EUR 521 |
Rat Golgi Protein 73 ELISA Kit (GP73) |
RK03694 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
RD-GP73-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
RD-GP73-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
RDR-GP73-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse Golgi Protein 73 (GP73) ELISA Kit |
RDR-GP73-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
trans-trans Muconic acid |
B7915-100 |
ApexBio |
100 mg |
EUR 108 |
trans-trans Muconic acid |
B7915-500 |
ApexBio |
500 mg |
EUR 166 |
Human Golgi phosphoprotein 3 (GOLPH3) ELISA Kit |
abx556004-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
ELISA kit for Human Golgi phosphoprotein 3 |
EK3275 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi phosphoprotein 3 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human GOLPH3/ Golgi phosphoprotein 3 ELISA Kit |
E1033Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Golgi phosphoprotein 3, GOLPH3 ELISA KIT |
ELI-09745h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Golgi Glycoprotein 1 (GLG1)ELISA Kit |
201-12-2724 |
SunredBio |
96 tests |
EUR 440 |
- This Golgi Glycoprotein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Golgi Phosphoprotein 3 (GOLPH3)ELISA Kit |
201-12-2725 |
SunredBio |
96 tests |
EUR 440 |
- This Golgi Phosphoprotein 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Tgoln2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3377103 |
ABM |
1.0 ug DNA |
EUR 154 |
Human GORASP1(Golgi reassembly-stacking protein 1) ELISA Kit |
EH8929 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q9BQQ3
- Alias: Golgi peripheral membrane protein p65/Golgi phosphoprotein 5/GOLPH5/Golgi reassembly-stacking protein of 65 kDa/GRASP65
|
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Golgi reassembly- stacking protein 1, GORASP1 ELISA KIT |
ELI-27463h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Golgi integral membrane protein 4, GOLIM4 ELISA KIT |
ELI-27934h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Golgi Reassembly Stacking Protein 1 (GORASP1) ELISA Kit |
abx259607-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human GP-73 (Golgi Protein 73) |
E-EL-H1313 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GP-73 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GP-73. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human GP-73 (Golgi Protein 73) in samples from Serum, Plasma, Cell supernatant |
Recombinant Human BD-2 Protein |
PROTO15263-2 |
BosterBio |
20ug |
EUR 317 |
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues. |
Recombinant Human Relaxin-2 Protein |
PROTP04090-2 |
BosterBio |
25ug |
EUR 317 |
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain. |
Recombinant Human PAI-2 Protein |
PROTP05120-2 |
BosterBio |
10ug |
EUR 317 |
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein. |
Recombinant Human MMP-2 Protein |
PROTP08253-2 |
BosterBio |
10ug |
EUR 317 |
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids). |
Recombinant Human TFF-2 Protein |
PROTQ03403-2 |
BosterBio |
20ug |
EUR 317 |
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds. |
BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer |
PROTP12643-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques. |
GORASP2 Golgi Reassembly Stacking Protein 2 Human Recombinant Protein |
PROTQ9H8Y8 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: GORASP2 Human Recombinant produced in E. coli is a single polypeptide chain containing 475 amino acids (1-452) and having a molecular mass of 49.5kDa.;GORASP2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Human Golgi Protein 73 (GP73) CLIA Kit |
20-abx492970 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
ELISA kit for Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR) |
KTE61674-48T |
Abbkine |
48T |
EUR 332 |
- MECR (Mitochondrial Trans-2-Enoyl-CoA Reductase) is a Protein Coding gene. Among its related pathways are Fatty acid metabolism and Fatty acid elongation. GO annotations related to this gene include oxidoreductase activity and trans-2-enoyl-CoA
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR) |
KTE61674-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MECR (Mitochondrial Trans-2-Enoyl-CoA Reductase) is a Protein Coding gene. Among its related pathways are Fatty acid metabolism and Fatty acid elongation. GO annotations related to this gene include oxidoreductase activity and trans-2-enoyl-CoA
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR) |
KTE61674-96T |
Abbkine |
96T |
EUR 539 |
- MECR (Mitochondrial Trans-2-Enoyl-CoA Reductase) is a Protein Coding gene. Among its related pathways are Fatty acid metabolism and Fatty acid elongation. GO annotations related to this gene include oxidoreductase activity and trans-2-enoyl-CoA
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
TGOLN2 Polyclonal Conjugated Antibody |
C29941 |
SAB |
100ul |
EUR 397 |
Mouse TGOLN2 shRNA Plasmid |
20-abx973249 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
IL-2 Interleukin-2 Human Recombinant Protein, His Tag |
PROTP60568-2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_ |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
TGOLN2 sgRNA CRISPR Lentivector set (Human) |
K2366801 |
ABM |
3 x 1.0 ug |
EUR 339 |
ErbB2 ErbB-2 Human Recombinant Protein |
PROTP04626-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: ErbB-2 Human Recombinant is a 43.4 kDa protein containing 397 amino acid residues of the human Herstatin, and an extra Methionine at N-Terminal (underlined), produced in E.coli. |
Mouse Golgi Membrane Protein 1 (Golm1) ELISA Kit |
abx518117-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Chicken Golgi Apparatus Protein 1 (GLG1) ELISA Kit |
abx555342-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 1-3 weeks.
|
Mouse Golgi Apparatus Protein 1 (GLG1) ELISA Kit |
abx556067-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Rat Golgi Apparatus Protein 1 (GLG1) ELISA Kit |
abx556215-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Mouse Golgi resident protein GCP60, Acbd3 ELISA KIT |
ELI-26547m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Golgi membrane protein 1, Golm1 ELISA KIT |
ELI-05456m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Mouse GP73 (Golgi Protein 73) |
ELK3906 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Golgi Protein 73 (GP73). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Golgi Prot
- Show more
|
Description: A sandwich ELISA kit for detection of Golgi Protein 73 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Chicken Golgi apparatus protein 1, GLG1 ELISA KIT |
ELI-31586c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Golgi apparatus protein 1, Glg1 ELISA KIT |
ELI-48301m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat Golgi apparatus protein 1, Glg1 ELISA KIT |
ELI-48470r |
Lifescience Market |
96 Tests |
EUR 886 |
ELISA kit for Rat GP73 (Golgi Protein 73) |
ELK7811 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Golgi Protein 73 (GP73). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Golgi Prot
- Show more
|
Description: A sandwich ELISA kit for detection of Golgi Protein 73 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Guinea pig Golgi Protein 73 (GP73) ELISA Kit |
abx357810-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
trans-2-Benzylamino-1-cyclohexanol |
20-abx185594 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
20-abx125891 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
20-abx112832 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
abx036267-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
20-abx003459 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
20-abx014496 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
abx028653-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
abx028653-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
20-abx321337 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
20-abx321338 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
20-abx328842 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
abx332636-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Golgi Reassembly Stacking Protein 2 (GORASP2) Antibody |
abx233564-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Human Golgi Protein 73 (GP73) Protein |
20-abx066897 |
Abbexa |
-
EUR 815.00
-
EUR 314.00
-
EUR 2611.00
-
EUR 982.00
-
EUR 578.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Golgi membrane protein GP73 Protein |
abx060158-100ug |
Abbexa |
100 ug |
EUR 1135 |
- Shipped within 5-10 working days.
|
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Human anti golgi appaus antibody,AGAA ELISA kit |
E01A2075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human anti golgi appaus antibody,AGAA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human anti golgi appaus antibody,AGAA ELISA kit |
E01A2075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human anti golgi appaus antibody,AGAA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human anti golgi appaus antibody,AGAA ELISA kit |
E01A2075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human anti golgi appaus antibody,AGAA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Golgi pH regulator B, GPR89B ELISA KIT |
ELI-09760h |
Lifescience Market |
96 Tests |
EUR 824 |
Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit