Human SYNC(Syncoilin) ELISA Kit

Human SYNC(Syncoilin) ELISA Kit

Human Syncoilin (SYNC) ELISA Kit
RD-SYNC-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Syncoilin (SYNC) ELISA Kit
RDR-SYNC-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Syncoilin (SYNC) ELISA Kit
RDR-SYNC-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Syncoilin, SYNC ELISA KIT
ELI-53119h	Lifescience Market	96 Tests	EUR 824

Human Syncoilin (SYNC) ELISA Kit
20-abx153203	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Syncoilin(SYNC)ELISA Kit
QY-E00204	Qayee Biotechnology	96T	EUR 361

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
4-SEF891Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Syncoilin elisa. Alternative names of the recognized antigen: Syncoilin-1 Intermediate Filament Protein Syncoilin intermediate filament 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syncoilin (SYNC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Syncoilin (SYNC) Antibody
20-abx128347	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Syncoilin (SYNC) Antibody
20-abx174693	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Syncoilin (SYNC) Antibody
20-abx310668	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody
abx238433-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Syncoilin (SYNC)
4-RPF891Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H7C4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 64.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Syncoilin expressed in: E.coli

Mouse Syncoilin, Sync ELISA KIT
ELI-41064m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human SYNC (Syncoilin)
ELK3923	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syncoilin (SYNC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syncoilin (SYNC). Show more
Description: A sandwich ELISA kit for detection of Syncoilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)
KTE60412-48T	Abbkine	48T	EUR 332
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)
KTE60412-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)
KTE60412-96T	Abbkine	96T	EUR 539
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Syncoilin (SYNC) Protein
20-abx166532	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Syncoilin (SYNC) CLIA Kit
20-abx495048	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse Syncoilin (SYNC)
KTE70284-48T	Abbkine	48T	EUR 332
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Syncoilin (SYNC)
KTE70284-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Syncoilin (SYNC)
KTE70284-96T	Abbkine	96T	EUR 539
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Syncoilin (SYNC) Antibody (HRP)
20-abx310669	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody (FITC)
20-abx310670	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody (Biotin)
20-abx310671	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine)
4-PAF891Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC)

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), APC
4-PAF891Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with APC.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), Biotinylated
4-PAF891Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with Biotin.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), Cy3
4-PAF891Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with Cy3.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), FITC
4-PAF891Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with FITC.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), HRP
4-PAF891Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with HRP.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), PE
4-PAF891Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with PE.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), APC-Cy7
4-PAF891Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with APC-Cy7.

SYNC ELISA KIT|Human
EF003394	Lifescience Market	96 Tests	EUR 689

SYNC siRNA
20-abx935788	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYNC siRNA
20-abx935789	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYNC Antibody
1-CSB-PA862034LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human SYNC shRNA Plasmid
20-abx962976	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Sync Recombinant Protein (Human)
RP043876	ABM	100 ug	Ask for price

anti- SYNC antibody
FNab08433	FN Test	100µg	EUR 548.75
Immunogen: syncoilin, intermediate filament protein Uniprot ID: Q9H7C4 Research Area: Neuroscience
Description: Antibody raised against SYNC

SYNC Polyclonal Antibody
A67194	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SYNC cloning plasmid
CSB-CL862034HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 456 Sequence: ATGGCAGAGAGCCGCCAGGACCTGGAGGAGGAGTATGAGCCTCAGTTCCTGCGGCTCCTAGAGAGGAAAGAAGCTGGGACCAAAGCTCTGCAGAGAACCCAGGCTGAGATCCAGGAAATGAAGGAGGCTCTGAGACCCCTGCAAGCAGAGGCCCGGCAGCTCCGCCTGCAAAACAG Show more
Description: A cloning plasmid for the SYNC gene.

Anti-SYNC antibody
PAab08433	Lifescience Market	100 ug	EUR 386

SYNC ORF Vector (Human) (pORF)
ORF014626	ABM	1.0 ug DNA	EUR 354

Mouse SYNC shRNA Plasmid
20-abx976752	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SYNC(Syncoilin) ELISA Kit