Human STH(Saitohin) ELISA Kit
 ELISA Kit) Human Saitohin (STH) ELISA Kit |
|
RD-STH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Saitohin (STH) ELISA Kit |
|
RD-STH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Saitohin (STH) ELISA Kit |
|
RDR-STH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Saitohin (STH) ELISA Kit |
|
RDR-STH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
) Human Saitohin (STH) |
|
1-CSB-EP022827HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 29.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Saitohin(STH) expressed in E.coli |
Human Saitohin (STH) ELISA Kit |
|
20-abx153012 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Saitohin (STH) ELISA Kit |
|
abx253789-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
 Human STH/ Saitohin ELISA Kit |
|
E2415Hu |
Sunlong |
1 Kit |
EUR 571 |
 ELISA Kit) Human STH(Saitohin) ELISA Kit |
|
EH0832 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q8IWL8
- Alias: STH/Saitohin
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Saitohin (STH) ELISA Kit |
|
abx572659-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Saitohin (STH) ELISA Kit |
|
SEE158Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids. |
Human Saitohin (STH) ELISA Kit |
|
SEE158Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids. |
Human Saitohin (STH) ELISA Kit |
|
SEE158Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids. |
Human Saitohin (STH) ELISA Kit |
|
SEE158Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids. |
Human Saitohin (STH) ELISA Kit |
|
4-SEE158Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Saitohin elisa. Alternative names of the recognized antigen: MAPTIT
- Microtubule-Associated Protein Tau Intronic Transcript
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Saitohin (STH) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
 Antibody) Saitohin (STH) Antibody |
|
20-abx178306 |
Abbexa |
|
|
|
|
Saitohin (STH) Antibody |
|
20-abx174455 |
Abbexa |
|
|
|
|
 Protein) Human Saitohin (STH) Protein |
|
20-abx654985 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 CLIA Kit) Human Saitohin (STH) CLIA Kit |
|
20-abx494522 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Human STH (Saitohin) |
|
ELK3836 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Saitohin (STH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Saitohin (STH). Nex
- Show more
|
|
Description: A sandwich ELISA kit for detection of Saitohin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Human Saitohin (STH) |
|
KTE60386-48T |
Abbkine |
48T |
EUR 332 |
- During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Saitohin (STH) |
|
KTE60386-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Saitohin (STH) |
|
KTE60386-96T |
Abbkine |
96T |
EUR 539 |
- During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 STH Antibody |
|
1-CSB-PA022827LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000 |
 STH siRNA |
|
20-abx935443 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Human STH shRNA Plasmid |
|
20-abx966624 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) STH Recombinant Protein (Human) |
|
RP043813 |
ABM |
100 ug |
Ask for price |
 STH cloning plasmid |
|
CSB-CL022827HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 387
- Sequence: atgagtgagggtggaggccaagtctcatgcatttttgcagcccccacaagactgtgcaggtggccggccctcattgaatgcggggttaatttaactcagcctctgtgtgagtggatgattcaggttgccagagacagaaccctcagcttagcatgggaagtagcttccctgttgac
- Show more
|
|
Description: A cloning plasmid for the STH gene. |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 (pORF)) STH ORF Vector (Human) (pORF) |
|
ORF014605 |
ABM |
1.0 ug DNA |
EUR 354 |
 STH Antibody, HRP conjugated |
|
1-CSB-PA022827LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 STH Antibody, FITC conjugated |
|
1-CSB-PA022827LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 STH Antibody, Biotin conjugated |
|
1-CSB-PA022827LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
) STH sgRNA CRISPR Lentivector set (Human) |
|
K2302001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 (Target 1)) STH sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2302002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) STH sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2302003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) STH sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2302004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) STH Protein Vector (Human) (pPB-C-His) |
|
PV058417 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) STH Protein Vector (Human) (pPB-N-His) |
|
PV058418 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) STH Protein Vector (Human) (pPM-C-HA) |
|
PV058419 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) STH Protein Vector (Human) (pPM-C-His) |
|
PV058420 |
ABM |
500 ng |
EUR 481 |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 Recombinant Human Saitohin Protein, His-SUMO, E.coli-100ug |
|
QP6736-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
 Recombinant Human Saitohin Protein, His-SUMO, E.coli-10ug |
|
QP6736-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
 Recombinant Human Saitohin Protein, His-SUMO, E.coli-1mg |
|
QP6736-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
 Recombinant Human Saitohin Protein, His-SUMO, E.coli-200ug |
|
QP6736-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
 Recombinant Human Saitohin Protein, His-SUMO, E.coli-500ug |
|
QP6736-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
 Recombinant Human Saitohin Protein, His-SUMO, E.coli-50ug |
|
QP6736-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
 Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
|
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
|
 CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 and Fast ligase (2.5ul)]) Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
|
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
|
) PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
) PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
 STH 3'UTR GFP Stable Cell Line |
|
TU074803 |
ABM |
1.0 ml |
EUR 2333 |
 STH 3'UTR Luciferase Stable Cell Line |
|
TU024803 |
ABM |
1.0 ml |
EUR 2333 |
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
) STH sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
|
K2302005 |
ABM |
3 x 1.0 ug |
EUR 376 |
 vWF Acty. Kit |
|
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
 vWF Ant. Kit |
|
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
) hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
|
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
|
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
) PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
 PrecisionX Multiplex gRNA Cloning Kit |
|
CAS9-GRNA-KIT |
SBI |
10 rxn |
EUR 445 |
|
|
 with goat anti-rabbit HRP secondary antibody) ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
|
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
|
) mRNAExpress mRNA Synthesis kit (5 reactions) |
|
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
 (Target 1)) STH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
|
K2302006 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 2)) STH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
|
K2302007 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 3)) STH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
|
K2302008 |
ABM |
1.0 ug DNA |
EUR 167 |
) CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent) |
|
CASCL9-100A-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS |
|
AP-STR-KIT-P |
CORNING |
1/pk |
EUR 721 |
|
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
 AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
|
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
|
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
 AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
|
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
|
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
 Human KIT/SCFR ELISA kit |
|
LF-EK50791 |
Abfrontier |
1×96T |
EUR 648 |
) Human CCRN4L/ Nocturnin ELISA KIT (Sandwich ELISA kit) |
|
ELI-21230h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA Kit (CUSTOM ELISA KIT)) Human GLMN (Glomulin) ELISA Kit (CUSTOM ELISA KIT) |
|
ELI-27987h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human Pentosidine ELISA Kit |
|
201-12-0005 |
SunredBio |
96 tests |
EUR 440 |
- This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Amylin ELISA Kit |
|
201-12-0017 |
SunredBio |
96 tests |
EUR 440 |
- This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human visfatin ELISA Kit |
|
201-12-0026 |
SunredBio |
96 tests |
EUR 440 |
- This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Secretin ELISA Kit |
|
201-12-0027 |
SunredBio |
96 tests |
EUR 440 |
- This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human omentin ELISA Kit |
|
201-12-0156 |
SunredBio |
96 tests |
EUR 440 |
- This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 human Resistin ELISA KIT |
|
201-12-0339 |
SunredBio |
96 tests |
EUR 440 |
- This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Collectin ELISA Kit |
|
201-12-0354 |
SunredBio |
96 tests |
EUR 440 |
- This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Agrin ELISA Kit |
|
201-12-0414 |
SunredBio |
96 tests |
EUR 440 |
- This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Thymosin ELISA Kit |
|
201-12-0416 |
SunredBio |
96 tests |
EUR 440 |
- This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human talin ELISA Kit |
|
201-12-0620 |
SunredBio |
96 tests |
EUR 440 |
- This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human ponticulin ELISA Kit |
|
201-12-0633 |
SunredBio |
96 tests |
EUR 440 |
- This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Slit2 ELISA Kit |
|
201-12-0662 |
SunredBio |
96 tests |
EUR 440 |
- This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human trypsin ELISA Kit |
|
201-12-0805 |
SunredBio |
96 tests |
EUR 440 |
- This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Elastase ELISA Kit |
|
201-12-0812 |
SunredBio |
96 tests |
EUR 440 |
- This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human ?-glucosidase ELISA Kit |
|
201-12-0854 |
SunredBio |
96 tests |
EUR 440 |
- This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human ?-lactamase ELISA Kit |
|
201-12-0856 |
SunredBio |
96 tests |
EUR 440 |
- This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Methylase ELISA Kit |
|
201-12-0927 |
SunredBio |
96 tests |
EUR 440 |
- This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Pancreastatin ELISA Kit |
|
201-12-0984 |
SunredBio |
96 tests |
EUR 440 |
- This Pancreastatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Cortisol ELISA Kit |
|
201-12-1004 |
SunredBio |
96 tests |
EUR 440 |
- This Cortisol ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Renin ELISA Kit |
|
201-12-1017 |
SunredBio |
96 tests |
EUR 440 |
- This Renin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human podocin ELISA Kit |
|
201-12-1083 |
SunredBio |
96 tests |
EUR 440 |
- This podocin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Nephrin ELISA Kit |
|
201-12-1092 |
SunredBio |
96 tests |
EUR 440 |
- This Nephrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human gelson ELISA Kit |
|
201-12-1204 |
SunredBio |
96 tests |
EUR 440 |
- This gelson ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Salusin ? ELISA Kit |
|
201-12-1269 |
SunredBio |
96 tests |
EUR 440 |
- This Salusin alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Salusin-? ELISA Kit |
|
201-12-1273 |
SunredBio |
96 tests |
EUR 440 |
- This Salusin-? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human chemerin ELISA Kit |
|
201-12-1436 |
SunredBio |
96 tests |
EUR 440 |
- This chemerin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human dystrophin ELISA Kit |
|
201-12-1446 |
SunredBio |
96 tests |
EUR 440 |
- This dystrophin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human preptin ELISA Kit |
|
201-12-1449 |
SunredBio |
96 tests |
EUR 440 |
- This preptin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human p16 ELISA Kit |
|
201-12-1638 |
SunredBio |
96 tests |
EUR 440 |
- This p16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 human colicin ELISA Kit |
|
201-12-1747 |
SunredBio |
96 tests |
EUR 440 |
- This colicin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Amebiasis ELISA Kit |
|
201-12-1748 |
SunredBio |
96 tests |
EUR 440 |
- This Amebiasis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 human schistosoma ELISA Kit |
|
201-12-1749 |
SunredBio |
96 tests |
EUR 440 |
- This schistosoma ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Enterovirus ELISA Kit |
|
201-12-1809 |
SunredBio |
96 tests |
EUR 440 |
- This Enterovirus ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human flagellin ELISA Kit |
|
201-12-1815 |
SunredBio |
96 tests |
EUR 440 |
- This flagellin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Cotinine ELISA Kit |
|
201-12-2044 |
SunredBio |
96 tests |
EUR 440 |
- This Cotinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Myostatin ELISA Kit |
|
201-12-2092 |
SunredBio |
96 tests |
EUR 440 |
- This Myostatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Haponin ELISA Kit |
|
201-12-2740 |
SunredBio |
96 tests |
EUR 440 |
- This Haponin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human ANG ELISA Kit |
|
55R-1555 |
Fitzgerald |
1 kit |
EUR 651 |
|
Description: ELISA kit for detection of ANG in the research laboratory |
 Human BDNF ELISA Kit |
|
55R-1556 |
Fitzgerald |
1 kit |
EUR 428 |
|
Description: ELISA kit for detection of BDNF in the research laboratory |
 Human BMP5 ELISA Kit |
|
55R-1559 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA kit for detection of BMP-5 in the research laboratory |
 Human BMP2 ELISA Kit |
|
55R-1560 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA kit for detection of BMP2 in the research laboratory |
 Human BMP4 ELISA Kit |
|
55R-1563 |
Fitzgerald |
1 kit |
EUR 651 |
|
Description: ELISA Kit for detection of BMP4 in the research laboratory |
 Human EGF ELISA Kit |
|
55R-1564 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for detection of EGF in the research laboratory |
 Human EGFR ELISA Kit |
|
55R-1566 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for detection of EGFR in the research laboratory |
 Human Eotaxin ELISA Kit |
|
55R-1567 |
Fitzgerald |
1 kit |
EUR 530 |
|
Description: ELISA kit for detection of Eotaxin in the research laboratory |
 Human FAS ELISA Kit |
|
55R-1570 |
Fitzgerald |
1 kit |
EUR 469 |
|
Description: ELISA kit for detection of FAS in the research laboratory |
 Human FASL ELISA Kit |
|
55R-1572 |
Fitzgerald |
1 kit |
EUR 651 |
|
Description: ELISA Kit for detection of FASL in the research laboratory |
 Human FGF9 ELISA Kit |
|
55R-1573 |
Fitzgerald |
1 kit |
EUR 671 |
|
Description: ELISA kit for detection of FGF9 in the research laboratory |
 Human Fibronectin ELISA kit |
|
55R-1574 |
Fitzgerald |
1 kit |
EUR 368 |
|
Description: ELISA kit for the detection of Fibronectin in the research laboratory |
 Human CX3CL1 ELISA Kit |
|
55R-1577 |
Fitzgerald |
1 kit |
EUR 617 |
|
Description: ELISA Kit for detection of CX3CL1 in the research laboratory |
Human CX3CL1 ELISA Kit |
|
55R-1578 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA Kit for detection of CX3CL1 in the research laboratory |
 Human GCSF ELISA kit |
|
55R-1579 |
Fitzgerald |
1 kit |
EUR 415 |
|
Description: ELISA kit for the detection of Human GCSF in the research laboratory |
 Human GDNF ELISA Kit |
|
55R-1581 |
Fitzgerald |
1 kit |
EUR 590 |
|
Description: ELISA kit for detection of GDNF in the research laboratory |
 Human GMCSF ELISA kit |
|
55R-1583 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA kit for the detection of GMCSF in the research laboratory |
 Human HGF ELISA kit |
|
55R-1586 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for the detection of Human HGF in the research laboratory |
 Human ICAM1 ELISA Kit |
|
55R-1587 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for detection of ICAM1 in the research laboratory |
 Human IGFBP1 ELISA Kit |
|
55R-1598 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for detection of IGFBP1 in the research laboratory |
 Human IGFBP3 ELISA kit |
|
55R-1600 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for the detection of IGFBP3 in the research laboratory |
 Human IL2 ELISA kit |
|
55R-1608 |
Fitzgerald |
1 kit |
EUR 496 |
|
Description: ELISA kit for the detection of IL2 in the research laboratory |
 Human IL3 ELISA Kit |
|
55R-1611 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for detection of IL3 in the research laboratory |
 Human IL4 ELISA Kit |
|
55R-1613 |
Fitzgerald |
1 kit |
EUR 415 |
|
Description: ELISA kit for detection of Human IL4 in the research laboratory |
 Human IL5 ELISA kit |
|
55R-1616 |
Fitzgerald |
1 kit |
EUR 530 |
|
Description: ELISA kit for the detection of IL5 in the research laboratory |
 Human IL6 ELISA Kit |
|
55R-1618 |
Fitzgerald |
1 kit |
EUR 415 |
|
Description: ELISA kit for detection of Human IL6 in the research laboratory |
 Human IL8 ELISA Kit |
|
55R-1621 |
Fitzgerald |
1 kit |
EUR 401 |
|
Description: ELISA kit for detection of Human IL8 in the research laboratory |
 Human IL10 ELISA Kit |
|
55R-1622 |
Fitzgerald |
1 kit |
EUR 401 |
|
Description: ELISA kit for detection of Human IL10 in the research laboratory |
 Human IL15 ELISA Kit |
|
55R-1629 |
Fitzgerald |
1 kit |
EUR 476 |
|
Description: ELISA kit for detection of IL15 in the research laboratory |
 Human IL17 ELISA Kit |
|
55R-1630 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for detection of IL17 in the research laboratory |
 Human Laminin ELISA Kit |
|
55R-1632 |
Fitzgerald |
1 kit |
EUR 651 |
|
Description: ELISA kit for detection of Laminin in the research laboratory |
 Human Leptin ELISA kit |
|
55R-1635 |
Fitzgerald |
1 kit |
EUR 476 |
|
Description: ELISA kit for the detection of Human Leptin in the research laboratory |
 Human MCP1 ELISA kit |
|
55R-1639 |
Fitzgerald |
1 kit |
EUR 476 |
|
Description: ELISA kit for the detection of MCP1 in the research laboratory |
 Human MCSF ELISA Kit |
|
55R-1640 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA Kit for detection of MCSF in the research laboratory |
 Human MDC ELISA Kit |
|
55R-1642 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for detection of MDC in the research laboratory |
 Human MMP1 ELISA Kit |
|
55R-1648 |
Fitzgerald |
1 kit |
EUR 590 |
|
Description: ELISA kit for detection of MMP1 in the research laboratory |
 Human MMP2 ELISA Kit |
|
55R-1649 |
Fitzgerald |
1 kit |
EUR 590 |
|
Description: ELISA kit for detection of MMP2 in the research laboratory |
 Human MMP3 ELISA Kit |
|
55R-1651 |
Fitzgerald |
1 kit |
EUR 590 |
|
Description: ELISA Kit for detection of MMP3 in the research laboratory |
 Human MMP8 ELISA Kit |
|
55R-1654 |
Fitzgerald |
1 kit |
EUR 671 |
|
Description: ELISA kit for detection of MMP8 in the research laboratory |
 Human MMP9 ELISA kit |
|
55R-1655 |
Fitzgerald |
1 kit |
EUR 671 |
|
Description: ELISA kit for the detection of MMP9 in the research laboratory |
 Human MMP13 ELISA kit |
|
55R-1657 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA kit for the detection of MMP13 in the research laboratory |
 Human NGFb ELISA Kit |
|
55R-1658 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA Kit for detection of NGFb in the research laboratory |
 Human OPG ELISA kit |
|
55R-1664 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for the detection of OPG in the research laboratory |
 Human OPN ELISA Kit |
|
55R-1666 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for detection of OPN in the research laboratory |
 Human PDGFAB ELISA Kit |
|
55R-1668 |
Fitzgerald |
1 kit |
EUR 476 |
|
Description: ELISA Kit for detection of PDGFAB in the research laboratory |
 Human Rantes ELISA Kit |
|
55R-1672 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for detection of Rantes in the research laboratory |
 Human TGFB1 ELISA Kit |
|
55R-1682 |
Fitzgerald |
1 kit |
EUR 476 |
|
Description: ELISA Kit for detection of TGFB1 in the research laboratory |
 Human TIE2 ELISA Kit |
|
55R-1686 |
Fitzgerald |
1 kit |
EUR 604 |
|
Description: ELISA kit for detection of TIE2 in the research laboratory |
 Human TIMP1 ELISA Kit |
|
55R-1687 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for detection of TIMP1 in the research laboratory |
 Human TIMP2 ELISA Kit |
|
55R-1688 |
Fitzgerald |
1 kit |
EUR 590 |
|
Description: ELISA kit for detection of TIMP2 in the research laboratory |
 Human TIMP3 ELISA Kit |
|
55R-1689 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA kit for detection of TIMP3 in the research laboratory |
 Human TNFR1 ELISA Kit |
|
55R-1693 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA Kit for detection of soluble TNFSR1 in the research laboratory |
 Human TNFR2 ELISA Kit |
|
55R-1694 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA Kit for detection of TNFR2 in the research laboratory |
Human STH(Saitohin) ELISA Kit
ELISA Kit)
