Human SLN(Sarcolipin) ELISA Kit

Human SLN(Sarcolipin) ELISA Kit

Human Sarcolipin (SLN) ELISA Kit

RD-SLN-Hu-96Tests 96 Tests
EUR 723

Human Sarcolipin (SLN) ELISA Kit

RDR-SLN-Hu-48Tests 48 Tests
EUR 544

Human Sarcolipin (SLN) ELISA Kit

RDR-SLN-Hu-96Tests 96 Tests
EUR 756

Rat Sarcolipin (SLN) ELISA Kit

DLR-SLN-Ra-48T 48T
EUR 549
  • Should the Rat Sarcolipin (SLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Sarcolipin (SLN) in samples from tissue homogenates or other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

DLR-SLN-Ra-96T 96T
EUR 718
  • Should the Rat Sarcolipin (SLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Sarcolipin (SLN) in samples from tissue homogenates or other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

RD-SLN-Ra-48Tests 48 Tests
EUR 557

Rat Sarcolipin (SLN) ELISA Kit

RD-SLN-Ra-96Tests 96 Tests
EUR 775

Rat Sarcolipin (SLN) ELISA Kit

RDR-SLN-Ra-48Tests 48 Tests
EUR 583

Rat Sarcolipin (SLN) ELISA Kit

RDR-SLN-Ra-96Tests 96 Tests
EUR 811

Human Sarcolipin, SLN ELISA KIT

ELI-29539h 96 Tests
EUR 824

Human Sarcolipin (SLN) ELISA Kit

20-abx153017
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

4-SEC848Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sarcolipin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sarcolipin (SLN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Sarcolipin ELISA Kit (SLN)

RK02300 96 Tests
EUR 521

Human Sarcolipin(SLN)ELISA Kit

QY-E03004 96T
EUR 361

Sarcolipin (SLN) Antibody

20-abx115382
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sarcolipin (SLN) Antibody

20-abx174457
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sarcolipin (SLN) Antibody

20-abx174458
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sarcolipin (SLN) Antibody

abx237987-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sarcolipin (SLN) Antibody

20-abx178309
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Sarcolipin (SLN) Antibody

20-abx178310
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Rat Sarcolipin, Sln ELISA KIT

ELI-18888r 96 Tests
EUR 886

Mouse Sarcolipin, Sln ELISA KIT

ELI-20144m 96 Tests
EUR 865

Rabbit Sarcolipin, SLN ELISA KIT

ELI-20145Ra 96 Tests
EUR 928

Rat Sarcolipin (SLN) ELISA Kit

20-abx156065
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

4-SEC848Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sarcolipin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Sarcolipin (SLN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Sarcolipin ELISA Kit (SLN)

RK03952 96 Tests
EUR 521

ELISA kit for Human SLN (Sarcolipin)

ELK3935 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcolipin (SLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcolipin (SLN).
  • Show more
Description: A sandwich ELISA kit for detection of Sarcolipin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)

KTE60578-48T 48T
EUR 332
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)

KTE60578-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)

KTE60578-96T 96T
EUR 539
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Sarcolipin (SLN) Protein

20-abx654987
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Sarcolipin (SLN) CLIA Kit

20-abx493935
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Rat SLN (Sarcolipin)

ELK7068 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcolipin (SLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcolipin (SLN).
  • Show more
Description: A sandwich ELISA kit for detection of Sarcolipin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)

KTE100238-48T 48T
EUR 332
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)

KTE100238-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)

KTE100238-96T 96T
EUR 539
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Sarcolipin (SLN) CLIA Kit

20-abx493936
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Sarcolipin (SLN) Protein

20-abx654988
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

SLN ELISA KIT|Human

EF003037 96 Tests
EUR 689

SLN ELISA Kit (Human) (OKCD01707)

OKCD01707 96 Wells
EUR 831
Description: Description of target: Reversibly inhibits the activity of ATP2A1 in sarcoplasmic reticulum by decreasing the apparent affinity of the ATPase for Ca2+. Modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in muscle. Required for muscle-based, non-shivering thermogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.121 ng/mL

SLN ELISA Kit (Rat) (OKDD00843)

OKDD00843 96 Wells
EUR 1040
Description: Description of target: Reversibly inhibits the activity of atp2a1 in sarcoplasmic reticulum by decreasing the apparent affinity of the atpase for ca2+. modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in muscle. required for muscle-based, non-shivering thermogenesis (by similarity).;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.058ng/mL

SLN siRNA

20-abx905135
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLN antibody

70R-20378 50 ul
EUR 435
Description: Rabbit polyclonal SLN antibody

SLN siRNA

20-abx934265
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLN siRNA

20-abx934266
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLN Antibody

1-CSB-PA021780GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLN. Recognizes SLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human SLN shRNA Plasmid

20-abx954475
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SLN Recombinant Protein (Human)

RP029320 100 ug Ask for price

SLN Recombinant Protein (Human)

RP043588 100 ug Ask for price

SLN cloning plasmid

CSB-CL021780HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 108
  • Sequence: atggtcctgggattgactgagatgctccggagctgcctgctctatgccctgagaccccactgctgtcattgtcacaggatgccattctccatccgagggcacctgtga
Description: A cloning plasmid for the SLN gene.

SLN cloning plasmid

CSB-CL021780HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 96
  • Sequence: ATGGGGATAAACACCCGGGAGCTGTTTCTCAACTTCACTATTGTCTTGATTACGGTTATTCTTATGTGGCTCCTTGTGAGGTCCTATCAGTACTGA
Description: A cloning plasmid for the SLN gene.

anti- SLN antibody

FNab07987 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:20-1:200
  • Immunogen: sarcolipin
  • Uniprot ID: O00631
  • Gene ID: 6588
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against SLN

Anti-SLN antibody

PAab07987 100 ug
EUR 386

Human SLN(Sarcolipin) ELISA Kit