Human SELENBP1(Selenium Binding Protein 1) ELISA Kit

Human SELENBP1(Selenium Binding Protein 1) ELISA Kit

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
RDR-SELENBP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
RDR-SELENBP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
20-abx153044	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Selenium-binding protein 1 (SELENBP1) ELISA Kit
abx251418-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human SELENBP1/ Selenium-binding protein 1 ELISA Kit
E2229Hu	Sunlong	1 Kit	EUR 571

Human SELENBP1(Selenium-binding protein 1) ELISA Kit
EH2088	FN Test	96T	EUR 567.6
Detection range: 31.25-2000 pg/ml Uniprot ID: Q13228 Alias: SELENBP1/SBP/SBP56/SP56/56 kDa selenium-binding protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75 pg/ml

Human Selenium- binding protein 1, SELENBP1 ELISA KIT
ELI-06660h	Lifescience Market	96 Tests	EUR 824

Human selenium binding protein 1(SELENBP1) ELISA Kit
CSB-E13947h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human selenium binding protein 1 (SELENBP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human selenium binding protein 1(SELENBP1) ELISA Kit
1-CSB-E13947h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human selenium binding protein 1(SELENBP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Selenium-binding protein 1 (SELENBP1) ELISA Kit
abx572666-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Selenium Binding Protein 1(SELENBP1)ELISA Kit
QY-E01003	Qayee Biotechnology	96T	EUR 361

Human Selenium Binding Protein 1 ELISA Kit (SELENBP1)
RK02256	Abclonal	96 Tests	EUR 521

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
SEG326Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
SEG326Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
SEG326Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
SEG326Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
4-SEG326Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Selenium Binding Protein 1 elisa. Alternative names of the recognized antigen: LPSB SP56 hSBP hSP56 SBP56 56 kDa selenium-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Selenium Binding Protein 1 (SELENBP1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Selenium Binding Protein 1 (SELENBP1) Protein
20-abx069015	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Selenium Binding Protein 1 (SELENBP1) Antibody
20-abx103200	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Selenium-Binding Protein 1 (SELENBP1) Antibody
abx117070-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Selenium-Binding Protein 1 (SELENBP1) Antibody
abx122246-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Selenium-Binding Protein 1 (SELENBP1) Antibody
20-abx141601	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Selenium Binding Protein 1 (SELENBP1) Antibody
20-abx174498	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Selenium-Binding Protein 1 (SELENBP1) Antibody
20-abx001134	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Selenium Binding Protein 1 (SELENBP1)
4-RPG326Hu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q13228 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.3kDa Isoelectric Point: Inquire
Description: Recombinant Human Selenium Binding Protein 1 expressed in: E.coli

Bovine Selenium- binding protein 1, SELENBP1 ELISA KIT
ELI-06662b	Lifescience Market	96 Tests	EUR 928

Mouse Selenium- binding protein 1, Selenbp1 ELISA KIT
ELI-06663m	Lifescience Market	96 Tests	EUR 865

Cow Selenium-binding protein 1 (SELENBP1) ELISA Kit
abx519321-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Selenium-binding protein 1 (SELENBP1) ELISA Kit
abx519323-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Selenium-binding protein 1 (SELENBP1) ELISA Kit
abx519324-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Selenium Binding Protein 1 (SELENBP1) CLIA Kit
20-abx495160	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human SELENBP1 (Selenium Binding Protein 1)
ELK3850	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Selenium Binding Protein 1 (SELENBP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Selenium Binding Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Selenium binding protein 1 (SELENBP1)
KTE60720-48T	Abbkine	48T	EUR 354
protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel Show more
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Selenium binding protein 1 (SELENBP1)
KTE60720-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel Show more
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Selenium binding protein 1 (SELENBP1)
KTE60720-96T	Abbkine	96T	EUR 572
protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel Show more
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Anti-Selenium Binding Protein 1/SELENBP1 Antibody
PA2216	BosterBio	100ug/vial	EUR 334

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human)
4-PAG326Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1)

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), APC
4-PAG326Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with APC.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), Biotinylated
4-PAG326Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with Biotin.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), Cy3
4-PAG326Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with Cy3.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), FITC
4-PAG326Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with FITC.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), HRP
4-PAG326Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with HRP.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), PE
4-PAG326Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with PE.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), APC-Cy7
4-PAG326Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with APC-Cy7.

ELISA kit for Human Selenium-binding protein 1
EK4255	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Selenium-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse Selenium-binding protein 1 (SBP1) ELISA Kit
abx259308-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Rat Selenium-binding protein 1 (SBP1) ELISA Kit
abx259346-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Mouse SBP1(Selenium-binding protein 1) ELISA Kit
EM1864	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Rat SBP1(Selenium-binding protein 1) ELISA Kit
ER1856	FN Test	96T	EUR 567.6
Detection range: 78.125-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.875pg/ml

Selenbp1/ Rat Selenbp1 ELISA Kit
ELI-06661r	Lifescience Market	96 Tests	EUR 886

Mouse Selenium- binding protein 2, Selenbp2 ELISA KIT
ELI-53194m	Lifescience Market	96 Tests	EUR 865

Human SELENBP1 ELISA Kit
ELA-E2076h	Lifescience Market	96 Tests	EUR 824

SELENBP1 ELISA KIT|Human
EF006170	Lifescience Market	96 Tests	EUR 689

SELENBP1 ELISA Kit (Human) (OKAN05628)
OKAN05628	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. The effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins, and decreased expression of this gene may be associated with several types of cancer. The encoded protein may play a selenium-dependent role in ubiquitination/deubiquitination-mediated protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

SELENBP1 ELISA Kit (Human) (OKCD08914)
OKCD08914	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: SELENBP1 belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

SELENBP1 ELISA Kit (Human) (OKEH01473)
OKEH01473	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. The effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins, and decreased expression of this gene may be associated with several types of cancer. The encoded protein may play a selenium-dependent role in ubiquitination/deubiquitination-mediated protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15 ng/mL

Monoclonal Selenium Binding Protein 1 Antibody (clone 3D4), Clone: 3D4
AMR09861G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human Selenium Binding Protein 1 (clone 3D4). The antibodies are raised in Mouse and are from clone 3D4. This antibody is applicable in WB and IHC-P

SELENBP1 Recombinant Protein (Human)
RP027949	ABM	100 ug	Ask for price

SELENBP1 ELISA Kit (Bovine) (OKCA02170)
OKCA02170	Aviva Systems Biology	96 Wells	EUR 930
Description: Description of target: Selenium-binding protein which may be involved in the sensing of reactive xenobiotics in the cytoplasm. May be involved in intra-Golgi protein transport.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 7.8 pg/mL

Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit
ER1005-1	AssayPro	96 Well Plate	EUR 417

Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit
ER2005-1	AssayPro	96 Well Plate	EUR 396

Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit
EC2202-1	AssayPro	96 Well Plate	EUR 417

Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
ER3005-1	AssayPro	96 Well Plate	EUR 396

SELENBP1 antibody
70R-2556	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SELENBP1 antibody raised against the N terminal of SELENBP1

SELENBP1 antibody
70R-3071	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SELENBP1 antibody raised against the C terminal of SELENBP1

SELENBP1 antibody
38221-100ul	SAB	100ul	EUR 252

SELENBP1 Antibody
DF6354	Affbiotech	200ul	EUR 304
Description: SELENBP1 Antibody detects endogenous levels of total SELENBP1.

SELENBP1 Antibody
CSB-PA020976KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against SELENBP1. Recognizes SELENBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SELENBP1 Antibody
CSB-PA020976KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against SELENBP1. Recognizes SELENBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SELENBP1 siRNA
20-abx904844	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SELENBP1 siRNA
20-abx932808	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SELENBP1 siRNA
20-abx932809	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SELENBP1 Antibody
ABD6354	Lifescience Market	100 ug	EUR 438

ULBP1 Human, UL16 Binding Protein 1 Human Recombinant Protein, Sf9
PROTQ9BZM6-1	BosterBio	Regular: 10ug	EUR 317
Description: ULBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216) and having a molecular mass of 23.4kDa (Molecular size on SDS-PAGE will appear at approximately 20-40kDa).;ULBP1 is fused to a 6 amino acid IgG His-Tag at C-terminus and purified by proprietary chromatographic techniques.

RLBP1 Human, Retinaldehyde Binding Protein 1 Human Recombinant Protein, sf9
PROTP12271-1	BosterBio	Regular: 10ug	EUR 317
Description: RLBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 326 amino acids (1-317) and having a molecular mass of 37.5kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;RLBP1 is fused to 6 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques.

Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit
EF2702-1	AssayPro	96 Well Plate	EUR 417

Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit
EF2705-1	AssayPro	96 Well Plate	EUR 417

FABP1 Fatty Acid Binding Protein-1 Human Recombinant Protein
PROTP07148-1	BosterBio	Regular: 10ug	EUR 317
Description: FABP1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 127 amino acids and having a total molecular mass of 14.2kDa (calculated).

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

SELENBP1 Recombinant Protein (Rat)
RP227957	ABM	100 ug	Ask for price

SELENBP1 Recombinant Protein (Mouse)
RP170645	ABM	100 ug	Ask for price

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human SELENBP1 shRNA Plasmid
20-abx955932	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit
EG3801-1	AssayPro	96 Well Plate	EUR 396

Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit
EG3811-1	AssayPro	96 Well Plate	EUR 417

SELENBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2115402	ABM	1.0 ug DNA	EUR 154

Canine Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
ECR3005-1	AssayPro	96 Well Plate	EUR 396

Mouse Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
EMR3005-1	AssayPro	96 Well Plate	EUR 417

SELENBP1 Blocking Peptide
33R-4604	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SELENBP1 antibody, catalog no. 70R-3071

SELENBP1 Blocking Peptide
33R-5778	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SELENBP1 antibody, catalog no. 70R-2556

SELENBP1 Blocking Peptide
DF6354-BP	Affbiotech	1mg	EUR 195

Mouse Selenbp1 Antibody
abx030957-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mouse Selenbp1 Antibody
abx030957-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SELENBP1 Conjugated Antibody
C38221	SAB	100ul	EUR 397

SELENBP1 cloning plasmid
CSB-CL618766HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1419 Sequence: atggctacgaaatgtgggaattgtggacccggctactccacccctctggaggccatgaaaggacccagggaagagatcgtctacctgccctgcatttaccgaaacacaggcactgaggccccagattatctggccactgtggatgttgaccccaagtctccccagtattgccagg Show more
Description: A cloning plasmid for the SELENBP1 gene.

Anti-SELENBP1 antibody
STJ25468	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes a member of the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. The effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins, and decreased expression of this gene may be associated with several types of cancer. The encoded protein may play a selenium-dependent role in ubiquitination/deubiquitination-mediated protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

AZGP1 Alpha-2-Glycoprotein 1 Zinc-Binding Human Recombinant Protein
PROTP25311-1	BosterBio	Regular: 20ug	EUR 317
Description: AZGP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (21-298 a.a) and having a molecular mass of 34.5kDa.;AZGP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

TARDBP (1-414) Human, TAR DNA Binding Protein (1-414 a.a.) Human Recombinant Protein, His Tag
PROTQ13148-1	BosterBio	Regular: 20ug	EUR 317
Description: TARDBP Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 450 amino acids (1-414 a.a) and having a total molecular mass of 48.8 kDa. TARDBP is fused to a 36 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

ELISA kit for Human O-phosphoseryl-tRNA (Sec) selenium transferase
EK2630	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human O-phosphoseryl-tRNA (Sec) selenium transferase in samples from serum, plasma, tissue homogenates and other biological fluids.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

SELENBP1 ORF Vector (Human) (pORF)
ORF009317	ABM	1.0 ug DNA	EUR 95

Human TANK-binding kinase 1-binding protein 1 (TBKBP1) ELISA Kit
abx385467-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

Human Calcineurin Binding Protein 1 ELISA kit
E01C0536-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit
E01C0536-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit
E01C0536-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit
E01G0084-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit
E01G0084-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit
E01G0084-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit
E01U0022-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit
E01U0022-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit
E01U0022-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit
E01H0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit
E01H0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit
E01H0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

SELENBP1 Protein Vector (Human) (pPB-C-His)
PV037265	ABM	500 ng	EUR 329

SELENBP1 Protein Vector (Human) (pPB-N-His)
PV037266	ABM	500 ng	EUR 329

SELENBP1 Protein Vector (Human) (pPM-C-HA)
PV037267	ABM	500 ng	EUR 329

SELENBP1 Protein Vector (Human) (pPM-C-His)
PV037268	ABM	500 ng	EUR 329

ULBP4 UL16 Binding Protein 4 Human Recombinant Protein
PROTQ8TD07-1	BosterBio	Regular: 10ug	EUR 317
Description: ULBP4 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Isoform 3 of Q8TD07) containing 192 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 22kDa.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit
EH5215-1	AssayPro	96 Well Plate	EUR 417

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ULBP2 Human, UL16 Binding Protein 2 Human Recombinant Protein, Sf9
PROTQ9BZM5-1	BosterBio	Regular: 10ug	EUR 317
Description: ULBP2 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216a.a) and having a molecular mass of 22.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). ULBP2 is fused to a 9 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

IL18BP Human, Interleukin-18 Binding Protein Human Recombinant Protein, Sf9
PROTO95998-1	BosterBio	Regular: 10ug	EUR 317
Description: IL18BP Human Recombinant produced in Sf9 Baculovirus cells is a single, non-glycosylated polypeptide chain containing 406 amino acids (31-194a.a) and having a molecular mass of 44.9kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). IL18BP is fused to a 239 amino acid hIgG-His-tag at C-terminus & purified by proprietary chromatographic techniques.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Mouse SELENBP1 shRNA Plasmid
20-abx972630	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat SELENBP1 shRNA Plasmid
20-abx987541	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

S100b S100 Calcium Binding Protein B Human Recombinant Protein
PROTP04271-1	BosterBio	Regular: 20ug	EUR 317
Description: S100b Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 92 amino acids (1-92 a.a.) and having a molecular mass of 10.7kDa.; The S100b is purified by proprietary chromatographic techniques.

S100A8 S100 Calcium Binding Protein A8 Human Recombinant Protein
PROTP05109-1	BosterBio	Regular: 20ug	EUR 317
Description: S100A8 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 93 amino acids (1-93 a.a.) and having a molecular mass of 10.8 kDa. The S100A8 is purified by proprietary chromatographic techniques.

FABP2 Fatty Acid Binding Protein-2 Human Recombinant Protein
PROTP12104-1	BosterBio	Regular: 25ug	EUR 317
Description: FABP2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 131 amino acids and having a molecular mass of 15.1kDa.;The FABP2 is purified by proprietary chromatographic techniques.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Selenbp1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7050502	ABM	1.0 ug DNA	EUR 154

Selenbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3981702	ABM	1.0 ug DNA	EUR 154

Human RalA Binding Protein 1 (RALBP1)ELISA Kit
201-12-2410	SunredBio	96 tests	EUR 440
This RalA Binding Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human AE Binding Protein 1 (AEBP1)ELISA Kit
201-12-2821	SunredBio	96 tests	EUR 440
This AE Binding Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human AE Binding Protein 1 (AEBP1) ELISA Kit
DLR-AEBP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human AE Binding Protein 1 (AEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human AE Binding Protein 1 (AEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human AE Binding Protein 1 (AEBP1) ELISA Kit
DLR-AEBP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human AE Binding Protein 1 (AEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human AE Binding Protein 1 (AEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit
DLR-PEBP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit
DLR-PEBP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human RalA Binding Protein 1 (RALBP1) ELISA Kit
DLR-RALBP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human RalA Binding Protein 1 (RALBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RalA Binding Protein 1 (RALBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human RalA Binding Protein 1 (RALBP1) ELISA Kit
DLR-RALBP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human RalA Binding Protein 1 (RALBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RalA Binding Protein 1 (RALBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Formin Binding Protein 1 (FNBP1) ELISA Kit
DLR-FNBP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Formin Binding Protein 1 (FNBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Formin Binding Protein 1 (FNBP1) in samples from tissue homogenates or other biological fluids.

Human Formin Binding Protein 1 (FNBP1) ELISA Kit
DLR-FNBP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Formin Binding Protein 1 (FNBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Formin Binding Protein 1 (FNBP1) in samples from tissue homogenates or other biological fluids.

Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit
DLR-HABP1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hyaluronan Binding Protein 1 (HABP1) in samples from serum, plasma or other biological fluids.

Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit
DLR-HABP1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Hyaluronan Binding Protein 1 (HABP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hyaluronan Binding Protein 1 (HABP1) in samples from serum, plasma or other biological fluids.

Human Phosphatidylethanolamine-binding protein 1(PEBP1) ELISA kit
CSB-EL017766HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylethanolamine-binding protein 1 (PEBP1) in samples from serum, plasma, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phosphatidylethanolamine-binding protein 1(PEBP1) ELISA kit
1-CSB-EL017766HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylethanolamine-binding protein 1(PEBP1) in samples from serum, plasma, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human X Box Binding Protein 1 ELISA kit
E01X0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human X Box Binding Protein 1 ELISA kit
E01X0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human X Box Binding Protein 1 ELISA kit
E01X0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit
E01S0420-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit
E01S0420-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit
E01S0420-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit
E01C1297-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit
E01C1297-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit
E01C1297-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit
E01A0983-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit
E01A0983-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit
E01A0983-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit
E01H1367-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit
E01H1367-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit
E01H1367-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AE Binding Protein 1 (AEBP1) ELISA Kit
20-abx150582	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Immunoglobulin Binding Protein 1 (IGBP1) ELISA Kit
20-abx156788	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit
20-abx156824	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Guanylate Binding Protein 1 (GBP1) ELISA Kit
20-abx156886	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Formin Binding Protein 1 (FNBP1) ELISA Kit
20-abx151573	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit
20-abx152693	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human RalA Binding Protein 1 (RALBP1) ELISA Kit
20-abx152919	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Polyadenylate-Binding Protein 1 (PABPC1) ELISA Kit
abx259760-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosome-binding protein 1 (RRBP1) ELISA Kit
abx250471-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit
abx250723-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx250983-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human HSPBP1(Hsp70-binding protein 1) ELISA Kit
EH4917	FN Test	96T	EUR 567.6
Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

ELISA kit for Human Ribosome-binding protein 1
EK2696	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ribosome-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Retinol-binding protein 1
EK2963	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Retinol-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Phosphatidylethanolamine-binding protein 1
EK3100	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phosphatidylethanolamine-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PEBP1/ Phosphatidylethanolamine-binding protein 1 ELISA Kit
E1903Hu	Sunlong	1 Kit	EUR 605

Human RRBP1/ Ribosome-binding protein 1 ELISA Kit
E2178Hu	Sunlong	1 Kit	EUR 605

Human RBP1/ Retinol-binding protein 1 ELISA Kit
E2832Hu	Sunlong	1 Kit	EUR 571

Human RRBP1(Ribosome-binding protein 1) ELISA Kit
EH1215	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q9P2E9 Alias: RRBP1/Ribosome-binding protein 1/Ribosome receptor protein/180 kDa ribosome receptor homolog/RRp
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human STXBP1(Syntaxin-binding protein 1) ELISA Kit
EH12697	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Alias: EIEE4/ MUNC18 1/ N Sec1/ p67/ Protein unc 18 homolog 1/ Protein unc 18 homolog A/ RBSEC1/ STXBP1/ syntaxin binding protein 1/ Unc 18A/ UNC18/ Unc18 1/ UNC18A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human RBP1(Retinol-binding protein 1) ELISA Kit
EH1381	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P09455 Alias: RBP1(Retinol Binding Protein 1, Cellular)/Retinol-binding protein 1/Cellular retinol-binding protein/CRBP/Cellular retinol-binding protein I/CRBP-I
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human PEBP1(Phosphatidylethanolamine-binding protein 1) ELISA Kit
EH1445	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P30086 Alias: PEBP1/HCNPpp/Neuropolypeptide h3/PBP/PEBP-1/HCNP/hippocampal cholinergic neurostimulating peptide/Neuropolypeptide h3/phosphatidylethanolamine binding protein 1/prostatic binding protein/Prost Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Hsp70- binding protein 1, HSPBP1 ELISA KIT
ELI-13077h	Lifescience Market	96 Tests	EUR 824

Human SH3KBP1- binding protein 1, SHKBP1 ELISA KIT
ELI-13606h	Lifescience Market	96 Tests	EUR 824

Human Polyadenylate- binding protein 1, PABPC1 ELISA KIT
ELI-12384h	Lifescience Market	96 Tests	EUR 824

Human Ribosome- binding protein 1, RRBP1 ELISA KIT
ELI-18387h	Lifescience Market	96 Tests	EUR 824

Human RalA- binding protein 1, RALBP1 ELISA KIT
ELI-22544h	Lifescience Market	96 Tests	EUR 824

Human NEDD4- binding protein 1, N4BP1 ELISA KIT
ELI-22852h	Lifescience Market	96 Tests	EUR 824

Human Syntaxin- binding protein 1, STXBP1 ELISA KIT
ELI-29278h	Lifescience Market	96 Tests	EUR 824

Human SELENBP1(Selenium Binding Protein 1) ELISA Kit