Human SELENBP1(Selenium Binding Protein 1) ELISA Kit

Human SELENBP1(Selenium Binding Protein 1) ELISA Kit

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit

RDR-SELENBP1-Hu-48Tests 48 Tests
EUR 544

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit

RDR-SELENBP1-Hu-96Tests 96 Tests
EUR 756

Human Selenium-binding protein 1 (SELENBP1) ELISA Kit

abx572666-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human SELENBP1/ Selenium-binding protein 1 ELISA Kit

E2229Hu 1 Kit
EUR 571

Human SELENBP1(Selenium-binding protein 1) ELISA Kit

EH2088 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q13228
  • Alias: SELENBP1/SBP/SBP56/SP56/56 kDa selenium-binding protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75 pg/ml

Human Selenium- binding protein 1, SELENBP1 ELISA KIT

ELI-06660h 96 Tests
EUR 824

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit

20-abx153044
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Selenium-binding protein 1 (SELENBP1) ELISA Kit

abx251418-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human selenium binding protein 1(SELENBP1) ELISA Kit

CSB-E13947h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human selenium binding protein 1 (SELENBP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human selenium binding protein 1(SELENBP1) ELISA Kit

1-CSB-E13947h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human selenium binding protein 1(SELENBP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Selenium Binding Protein 1 ELISA Kit (SELENBP1)

RK02256 96 Tests
EUR 521

Human Selenium Binding Protein 1(SELENBP1)ELISA Kit

QY-E01003 96T
EUR 361

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit

SEG326Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit

SEG326Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit

SEG326Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit

SEG326Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit

4-SEG326Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Selenium Binding Protein 1 elisa. Alternative names of the recognized antigen: LPSB
  • SP56
  • hSBP
  • hSP56
  • SBP56
  • 56 kDa selenium-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Selenium Binding Protein 1 (SELENBP1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Selenium Binding Protein 1 (SELENBP1) Protein

20-abx069015
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Selenium-Binding Protein 1 (SELENBP1) Antibody

abx117070-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Selenium-Binding Protein 1 (SELENBP1) Antibody

abx122246-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Selenium-Binding Protein 1 (SELENBP1) Antibody

20-abx001134
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Selenium-Binding Protein 1 (SELENBP1) Antibody

20-abx141601
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Selenium Binding Protein 1 (SELENBP1) Antibody

20-abx103200
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Selenium Binding Protein 1 (SELENBP1) Antibody

20-abx174498
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Selenium Binding Protein 1 (SELENBP1)

4-RPG326Hu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13228
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Selenium Binding Protein 1 expressed in: E.coli

Cow Selenium-binding protein 1 (SELENBP1) ELISA Kit

abx519321-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Selenium-binding protein 1 (SELENBP1) ELISA Kit

abx519323-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Selenium-binding protein 1 (SELENBP1) ELISA Kit

abx519324-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Bovine Selenium- binding protein 1, SELENBP1 ELISA KIT

ELI-06662b 96 Tests
EUR 928

Mouse Selenium- binding protein 1, Selenbp1 ELISA KIT

ELI-06663m 96 Tests
EUR 865

Human Selenium Binding Protein 1 (SELENBP1) CLIA Kit

20-abx495160
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human SELENBP1 (Selenium Binding Protein 1)

ELK3850 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Selenium Binding Protein 1 (SELENBP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Selenium Binding Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Selenium binding protein 1 (SELENBP1)

KTE60720-48T 48T
EUR 354
  • protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Selenium binding protein 1 (SELENBP1)

KTE60720-5platesof96wells 5 plates of 96 wells
EUR 2252
  • protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Selenium binding protein 1 (SELENBP1)

KTE60720-96T 96T
EUR 572
  • protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Anti-Selenium Binding Protein 1/SELENBP1 Antibody

PA2216 100ug/vial
EUR 334

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human)

4-PAG326Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1)

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), APC

4-PAG326Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with APC.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), Biotinylated

4-PAG326Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with Biotin.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), Cy3

4-PAG326Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with Cy3.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), FITC

4-PAG326Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with FITC.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), HRP

4-PAG326Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with HRP.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), PE

4-PAG326Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with PE.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), APC-Cy7

4-PAG326Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with APC-Cy7.

ELISA kit for Human Selenium-binding protein 1

EK4255 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Selenium-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Rat SBP1(Selenium-binding protein 1) ELISA Kit

ER1856 96T
EUR 567.6
  • Detection range: 78.125-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.875pg/ml

Mouse SBP1(Selenium-binding protein 1) ELISA Kit

EM1864 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Mouse Selenium-binding protein 1 (SBP1) ELISA Kit

abx259308-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Rat Selenium-binding protein 1 (SBP1) ELISA Kit

abx259346-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Selenbp1/ Rat Selenbp1 ELISA Kit

ELI-06661r 96 Tests
EUR 886

Mouse Selenium- binding protein 2, Selenbp2 ELISA KIT

ELI-53194m 96 Tests
EUR 865

Human SELENBP1 ELISA Kit

ELA-E2076h 96 Tests
EUR 824

SELENBP1 ELISA KIT|Human

EF006170 96 Tests
EUR 689

Monoclonal Selenium Binding Protein 1 Antibody (clone 3D4), Clone: 3D4

AMR09861G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human Selenium Binding Protein 1 (clone 3D4). The antibodies are raised in Mouse and are from clone 3D4. This antibody is applicable in WB and IHC-P

SELENBP1 Recombinant Protein (Human)

RP027949 100 ug Ask for price

Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit

ER1005-1 96 Well Plate
EUR 417

Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit

ER2005-1 96 Well Plate
EUR 396

Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit

EC2202-1 96 Well Plate
EUR 417

Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit

ER3005-1 96 Well Plate
EUR 396

SELENBP1 siRNA

20-abx904844
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SELENBP1 antibody

70R-2556 50 ug
EUR 467
Description: Rabbit polyclonal SELENBP1 antibody raised against the N terminal of SELENBP1

SELENBP1 antibody

70R-3071 50 ug
EUR 467
Description: Rabbit polyclonal SELENBP1 antibody raised against the C terminal of SELENBP1

SELENBP1 Antibody

ABD6354 100 ug
EUR 438

SELENBP1 antibody

38221-100ul 100ul
EUR 252

SELENBP1 Antibody

DF6354 200ul
EUR 304
Description: SELENBP1 Antibody detects endogenous levels of total SELENBP1.

SELENBP1 siRNA

20-abx932808
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SELENBP1 siRNA

20-abx932809
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SELENBP1 Antibody

CSB-PA020976KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against SELENBP1. Recognizes SELENBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SELENBP1 Antibody

CSB-PA020976KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against SELENBP1. Recognizes SELENBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit

EF2702-1 96 Well Plate
EUR 417

Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit

EF2705-1 96 Well Plate
EUR 417

RLBP1 Human, Retinaldehyde Binding Protein 1 Human Recombinant Protein, sf9

PROTP12271-1 Regular: 10ug
EUR 317
Description: RLBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 326 amino acids (1-317) and having a molecular mass of 37.5kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;RLBP1 is fused to 6 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques.

ULBP1 Human, UL16 Binding Protein 1 Human Recombinant Protein, Sf9

PROTQ9BZM6-1 Regular: 10ug
EUR 317
Description: ULBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216) and having a molecular mass of 23.4kDa (Molecular size on SDS-PAGE will appear at approximately 20-40kDa).;ULBP1 is fused to a 6 amino acid IgG His-Tag at C-terminus and purified by proprietary chromatographic techniques.

FABP1 Fatty Acid Binding Protein-1 Human Recombinant Protein

PROTP07148-1 Regular: 10ug
EUR 317
Description: FABP1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 127 amino acids and having a total molecular mass of 14.2kDa (calculated).

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

SELENBP1 Recombinant Protein (Rat)

RP227957 100 ug Ask for price

SELENBP1 Recombinant Protein (Mouse)

RP170645 100 ug Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human SELENBP1 shRNA Plasmid

20-abx955932
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit

EG3801-1 96 Well Plate
EUR 396

Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit

EG3811-1 96 Well Plate
EUR 417

Canine Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit

ECR3005-1 96 Well Plate
EUR 396

Mouse Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit

EMR3005-1 96 Well Plate
EUR 417

SELENBP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2115402 1.0 ug DNA
EUR 154

SELENBP1 Conjugated Antibody

C38221 100ul
EUR 397

SELENBP1 cloning plasmid

CSB-CL618766HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1419
  • Sequence: atggctacgaaatgtgggaattgtggacccggctactccacccctctggaggccatgaaaggacccagggaagagatcgtctacctgccctgcatttaccgaaacacaggcactgaggccccagattatctggccactgtggatgttgaccccaagtctccccagtattgccagg
  • Show more
Description: A cloning plasmid for the SELENBP1 gene.

Mouse Selenbp1 Antibody

abx030957-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Selenbp1 Antibody

abx030957-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SELENBP1 Blocking Peptide

33R-4604 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SELENBP1 antibody, catalog no. 70R-3071

SELENBP1 Blocking Peptide

33R-5778 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SELENBP1 antibody, catalog no. 70R-2556

SELENBP1 Blocking Peptide

DF6354-BP 1mg
EUR 195

Anti-SELENBP1 antibody

STJ25468 100 µl
EUR 413
Description: This gene encodes a member of the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. The effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins, and decreased expression of this gene may be associated with several types of cancer. The encoded protein may play a selenium-dependent role in ubiquitination/deubiquitination-mediated protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

AZGP1 Alpha-2-Glycoprotein 1 Zinc-Binding Human Recombinant Protein

PROTP25311-1 Regular: 20ug
EUR 317
Description: AZGP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (21-298 a.a) and having a molecular mass of 34.5kDa.;AZGP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

ELISA kit for Human O-phosphoseryl-tRNA (Sec) selenium transferase

EK2630 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human O-phosphoseryl-tRNA (Sec) selenium transferase in samples from serum, plasma, tissue homogenates and other biological fluids.

TARDBP (1-414) Human, TAR DNA Binding Protein (1-414 a.a.) Human Recombinant Protein, His Tag

PROTQ13148-1 Regular: 20ug
EUR 317
Description: TARDBP Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 450 amino acids (1-414 a.a) and having a total molecular mass of 48.8 kDa. TARDBP is fused to a 36 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

SELENBP1 ORF Vector (Human) (pORF)

ORF009317 1.0 ug DNA
EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human TANK-binding kinase 1-binding protein 1 (TBKBP1) ELISA Kit

abx385467-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

Human UL16 Binding protein 1 ELISA kit

E01U0022-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit

E01U0022-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit

E01U0022-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit

E01C0536-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit

E01C0536-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit

E01C0536-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit

E01G0084-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit

E01G0084-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit

E01G0084-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit

E01H0035-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit

E01H0035-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hyaluronan Binding Protein 1 ELISA kit

E01H0035-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SELENBP1 Protein Vector (Human) (pPB-C-His)

PV037265 500 ng
EUR 329

SELENBP1 Protein Vector (Human) (pPB-N-His)

PV037266 500 ng
EUR 329

SELENBP1 Protein Vector (Human) (pPM-C-HA)

PV037267 500 ng
EUR 329

SELENBP1 Protein Vector (Human) (pPM-C-His)

PV037268 500 ng
EUR 329

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

ULBP4 UL16 Binding Protein 4 Human Recombinant Protein

PROTQ8TD07-1 Regular: 10ug
EUR 317
Description: ULBP4 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Isoform 3 of Q8TD07) containing 192 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 22kDa.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit

EH5215-1 96 Well Plate
EUR 417

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

IL18BP Human, Interleukin-18 Binding Protein Human Recombinant Protein, Sf9

PROTO95998-1 Regular: 10ug
EUR 317
Description: IL18BP Human Recombinant produced in Sf9 Baculovirus cells is a single, non-glycosylated polypeptide chain containing 406 amino acids (31-194a.a) and having a molecular mass of 44.9kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). IL18BP is fused to a 239 amino acid hIgG-His-tag at C-terminus & purified by proprietary chromatographic techniques.

ULBP2 Human, UL16 Binding Protein 2 Human Recombinant Protein, Sf9

PROTQ9BZM5-1 Regular: 10ug
EUR 317
Description: ULBP2 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216a.a) and having a molecular mass of 22.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). ULBP2 is fused to a 9 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Rat SELENBP1 shRNA Plasmid

20-abx987541
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SELENBP1 shRNA Plasmid

20-abx972630
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

S100b S100 Calcium Binding Protein B Human Recombinant Protein

PROTP04271-1 Regular: 20ug
EUR 317
Description: S100b Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 92 amino acids (1-92 a.a.) and having a molecular mass of 10.7kDa.; The S100b is purified by proprietary chromatographic techniques.

S100A8 S100 Calcium Binding Protein A8 Human Recombinant Protein

PROTP05109-1 Regular: 20ug
EUR 317
Description: S100A8 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 93 amino acids (1-93 a.a.) and having a molecular mass of 10.8 kDa. The S100A8 is purified by proprietary chromatographic techniques.

FABP2 Fatty Acid Binding Protein-2 Human Recombinant Protein

PROTP12104-1 Regular: 25ug
EUR 317
Description: FABP2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 131 amino acids and having a molecular mass of 15.1kDa.;The FABP2 is purified by proprietary chromatographic techniques.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human AE Binding Protein 1 (AEBP1) ELISA Kit

abx520682-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Retinol-binding protein 1 (RBP1) ELISA Kit

abx570744-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit

abx571045-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human AE Binding Protein 1 (AEBP1) ELISA Kit

abx572539-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human X Box Binding Protein 1 ELISA kit

E01X0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human X Box Binding Protein 1 ELISA kit

E01X0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human X Box Binding Protein 1 ELISA kit

E01X0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit

E01C1297-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit

E01C1297-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium binding protein 1(CABP1) ELISA kit

E01C1297-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit

E01A0983-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit

E01A0983-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin binding LIM protein 1 ELISA kit

E01A0983-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit

E01S0420-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit

E01S0420-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syntaxin binding protein 1(STXBP1) ELISA kit

E01S0420-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit

E01H1367-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit

E01H1367-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Heme binding protein 1(HEBP1) ELISA kit

E01H1367-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Ribosome-binding protein 1

EK2696 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ribosome-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Retinol-binding protein 1

EK2963 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Retinol-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Phosphatidylethanolamine-binding protein 1

EK3100 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phosphatidylethanolamine-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human HSPBP1(Hsp70-binding protein 1) ELISA Kit

EH4917 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human PEBP1/ Phosphatidylethanolamine-binding protein 1 ELISA Kit

E1903Hu 1 Kit
EUR 605

Human RRBP1/ Ribosome-binding protein 1 ELISA Kit

E2178Hu 1 Kit
EUR 605

Human RBP1/ Retinol-binding protein 1 ELISA Kit

E2832Hu 1 Kit
EUR 571

Human RRBP1(Ribosome-binding protein 1) ELISA Kit

EH1215 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q9P2E9
  • Alias: RRBP1/Ribosome-binding protein 1/Ribosome receptor protein/180 kDa ribosome receptor homolog/RRp
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human STXBP1(Syntaxin-binding protein 1) ELISA Kit

EH12697 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Alias: EIEE4/ MUNC18 1/ N Sec1/ p67/ Protein unc 18 homolog 1/ Protein unc 18 homolog A/ RBSEC1/ STXBP1/ syntaxin binding protein 1/ Unc 18A/ UNC18/ Unc18 1/ UNC18A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human RBP1(Retinol-binding protein 1) ELISA Kit

EH1381 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P09455
  • Alias: RBP1(Retinol Binding Protein 1, Cellular)/Retinol-binding protein 1/Cellular retinol-binding protein/CRBP/Cellular retinol-binding protein I/CRBP-I
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human PEBP1(Phosphatidylethanolamine-binding protein 1) ELISA Kit

EH1445 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P30086
  • Alias: PEBP1/HCNPpp/Neuropolypeptide h3/PBP/PEBP-1/HCNP/hippocampal cholinergic neurostimulating peptide/Neuropolypeptide h3/phosphatidylethanolamine binding protein 1/prostatic binding protein/Prost
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Polyadenylate- binding protein 1, PABPC1 ELISA KIT

ELI-12384h 96 Tests
EUR 824

Human Hsp70- binding protein 1, HSPBP1 ELISA KIT

ELI-13077h 96 Tests
EUR 824

Human SH3KBP1- binding protein 1, SHKBP1 ELISA KIT

ELI-13606h 96 Tests
EUR 824

Human Ribosome- binding protein 1, RRBP1 ELISA KIT

ELI-18387h 96 Tests
EUR 824

Human RalA- binding protein 1, RALBP1 ELISA KIT

ELI-22544h 96 Tests
EUR 824

Human NEDD4- binding protein 1, N4BP1 ELISA KIT

ELI-22852h 96 Tests
EUR 824

Human Retinol- binding protein 1, RBP1 ELISA KIT

ELI-04010h 96 Tests
EUR 824

Human Formin- binding protein 1, FNBP1 ELISA KIT

ELI-07787h 96 Tests
EUR 824

Human Oxysterol- binding protein 1, OSBP ELISA KIT

ELI-35189h 96 Tests
EUR 824

Human Heme- binding protein 1, HEBP1 ELISA KIT

ELI-43925h 96 Tests
EUR 824

Human Retinaldehyde- binding protein 1, RLBP1 ELISA KIT

ELI-44948h 96 Tests
EUR 824

Human Polyglutamine- binding protein 1, PQBP1 ELISA KIT

ELI-45429h 96 Tests
EUR 824

Human Mis18- binding protein 1, MIS18BP1 ELISA KIT

ELI-46264h 96 Tests
EUR 824

Human Syntaxin- binding protein 1, STXBP1 ELISA KIT

ELI-29278h 96 Tests
EUR 824

Human Tax1- binding protein 1, TAX1BP1 ELISA KIT

ELI-29735h 96 Tests
EUR 824

Human Upstream- binding protein 1, UBP1 ELISA KIT

ELI-39972h 96 Tests
EUR 824

Human GTP- binding protein 1, GTPBP1 ELISA KIT

ELI-48517h 96 Tests
EUR 824

Human Immunoglobulin- binding protein 1, IGBP1 ELISA KIT

ELI-48699h 96 Tests
EUR 824

Human Calcium- binding protein 1, CABP1 ELISA KIT

ELI-50448h 96 Tests
EUR 824

Human UHRF1- binding protein 1, UHRF1BP1 ELISA KIT

ELI-51372h 96 Tests
EUR 824

Human Immunoglobulin Binding Protein 1 (IGBP1) ELISA Kit

20-abx156788
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit

20-abx156824
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Guanylate Binding Protein 1 (GBP1) ELISA Kit

20-abx156886
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human AE Binding Protein 1 (AEBP1) ELISA Kit

20-abx150582
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Formin Binding Protein 1 (FNBP1) ELISA Kit

20-abx151573
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit

20-abx152693
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human RalA Binding Protein 1 (RALBP1) ELISA Kit

20-abx152919
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Polyadenylate-Binding Protein 1 (PABPC1) ELISA Kit

abx259760-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human GATA Binding Protein 1 (GATA1) ELISA Kit

abx351494-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Oxysterol Binding Protein 1 (OSBP) ELISA Kit

abx381983-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human PPFIA Binding Protein 1 (PPFIBP1) ELISA Kit

abx382388-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Polyglutamine-binding protein 1 (PQBP1) ELISA Kit

abx382444-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human SET Binding Protein 1 (SETBP1) ELISA Kit

abx383123-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human SH3KBP1-binding protein 1 (SHKBP1) ELISA Kit

abx383189-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human SELENBP1(Selenium Binding Protein 1) ELISA Kit