Human SELENBP1(Selenium Binding Protein 1) ELISA Kit
Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit |
RDR-SELENBP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit |
RDR-SELENBP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Selenium-binding protein 1 (SELENBP1) ELISA Kit |
abx572666-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human SELENBP1/ Selenium-binding protein 1 ELISA Kit |
E2229Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SELENBP1(Selenium-binding protein 1) ELISA Kit |
EH2088 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: Q13228
- Alias: SELENBP1/SBP/SBP56/SP56/56 kDa selenium-binding protein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75 pg/ml |
Human Selenium- binding protein 1, SELENBP1 ELISA KIT |
ELI-06660h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit |
20-abx153044 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Selenium-binding protein 1 (SELENBP1) ELISA Kit |
abx251418-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human selenium binding protein 1(SELENBP1) ELISA Kit |
CSB-E13947h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human selenium binding protein 1 (SELENBP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human selenium binding protein 1(SELENBP1) ELISA Kit |
1-CSB-E13947h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human selenium binding protein 1(SELENBP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Selenium Binding Protein 1 ELISA Kit (SELENBP1) |
RK02256 |
Abclonal |
96 Tests |
EUR 521 |
Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit |
SEG326Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit |
SEG326Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit |
SEG326Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit |
SEG326Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit |
4-SEG326Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Selenium Binding Protein 1 elisa. Alternative names of the recognized antigen: LPSB
- SP56
- hSBP
- hSP56
- SBP56
- 56 kDa selenium-binding protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Selenium Binding Protein 1 (SELENBP1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Selenium Binding Protein 1 (SELENBP1) Protein |
20-abx069015 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Selenium-Binding Protein 1 (SELENBP1) Antibody |
abx117070-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Selenium-Binding Protein 1 (SELENBP1) Antibody |
abx122246-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Selenium-Binding Protein 1 (SELENBP1) Antibody |
20-abx001134 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Selenium-Binding Protein 1 (SELENBP1) Antibody |
20-abx141601 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Selenium Binding Protein 1 (SELENBP1) Antibody |
20-abx103200 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Selenium Binding Protein 1 (SELENBP1) Antibody |
20-abx174498 |
Abbexa |
|
|
|
Recombinant Selenium Binding Protein 1 (SELENBP1) |
4-RPG326Hu01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q13228
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Selenium Binding Protein 1 expressed in: E.coli |
Cow Selenium-binding protein 1 (SELENBP1) ELISA Kit |
abx519321-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Selenium-binding protein 1 (SELENBP1) ELISA Kit |
abx519323-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Selenium-binding protein 1 (SELENBP1) ELISA Kit |
abx519324-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Bovine Selenium- binding protein 1, SELENBP1 ELISA KIT |
ELI-06662b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Selenium- binding protein 1, Selenbp1 ELISA KIT |
ELI-06663m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Selenium Binding Protein 1 (SELENBP1) CLIA Kit |
20-abx495160 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human SELENBP1 (Selenium Binding Protein 1) |
ELK3850 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Selenium Binding Protein 1 (SELENBP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Selenium Binding Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Selenium binding protein 1 (SELENBP1) |
KTE60720-48T |
Abbkine |
48T |
EUR 354 |
- protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Selenium binding protein 1 (SELENBP1) |
KTE60720-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Selenium binding protein 1 (SELENBP1) |
KTE60720-96T |
Abbkine |
96T |
EUR 572 |
- protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Anti-Selenium Binding Protein 1/SELENBP1 Antibody |
PA2216 |
BosterBio |
100ug/vial |
EUR 334 |
Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human) |
4-PAG326Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1) |
Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), APC |
4-PAG326Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with APC. |
Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), Biotinylated |
4-PAG326Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with Biotin. |
Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), Cy3 |
4-PAG326Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with Cy3. |
Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), FITC |
4-PAG326Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with FITC. |
Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), HRP |
4-PAG326Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with HRP. |
Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), PE |
4-PAG326Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with PE. |
Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAG326Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with APC-Cy7. |
ELISA kit for Human Selenium-binding protein 1 |
EK4255 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Selenium-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Rat SBP1(Selenium-binding protein 1) ELISA Kit |
ER1856 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78.125-5000 pg/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.875pg/ml |
Mouse SBP1(Selenium-binding protein 1) ELISA Kit |
EM1864 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml |
Mouse Selenium-binding protein 1 (SBP1) ELISA Kit |
abx259308-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Rat Selenium-binding protein 1 (SBP1) ELISA Kit |
abx259346-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Mouse Selenium- binding protein 2, Selenbp2 ELISA KIT |
ELI-53194m |
Lifescience Market |
96 Tests |
EUR 865 |
Monoclonal Selenium Binding Protein 1 Antibody (clone 3D4), Clone: 3D4 |
AMR09861G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human Selenium Binding Protein 1 (clone 3D4). The antibodies are raised in Mouse and are from clone 3D4. This antibody is applicable in WB and IHC-P |
SELENBP1 Recombinant Protein (Human) |
RP027949 |
ABM |
100 ug |
Ask for price |
Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit |
ER1005-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit |
ER2005-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit |
EC2202-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit |
ER3005-1 |
AssayPro |
96 Well Plate |
EUR 396 |
SELENBP1 siRNA |
20-abx904844 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SELENBP1 antibody |
70R-2556 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SELENBP1 antibody raised against the N terminal of SELENBP1 |
SELENBP1 antibody |
70R-3071 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SELENBP1 antibody raised against the C terminal of SELENBP1 |
SELENBP1 antibody |
38221-100ul |
SAB |
100ul |
EUR 252 |
SELENBP1 Antibody |
DF6354 |
Affbiotech |
200ul |
EUR 304 |
Description: SELENBP1 Antibody detects endogenous levels of total SELENBP1. |
SELENBP1 siRNA |
20-abx932808 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SELENBP1 siRNA |
20-abx932809 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SELENBP1 Antibody |
CSB-PA020976KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against SELENBP1. Recognizes SELENBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
SELENBP1 Antibody |
CSB-PA020976KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against SELENBP1. Recognizes SELENBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit |
EF2702-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit |
EF2705-1 |
AssayPro |
96 Well Plate |
EUR 417 |
RLBP1 Human, Retinaldehyde Binding Protein 1 Human Recombinant Protein, sf9 |
PROTP12271-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: RLBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 326 amino acids (1-317) and having a molecular mass of 37.5kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;RLBP1 is fused to 6 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques. |
ULBP1 Human, UL16 Binding Protein 1 Human Recombinant Protein, Sf9 |
PROTQ9BZM6-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: ULBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216) and having a molecular mass of 23.4kDa (Molecular size on SDS-PAGE will appear at approximately 20-40kDa).;ULBP1 is fused to a 6 amino acid IgG His-Tag at C-terminus and purified by proprietary chromatographic techniques. |
FABP1 Fatty Acid Binding Protein-1 Human Recombinant Protein |
PROTP07148-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: FABP1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 127 amino acids and having a total molecular mass of 14.2kDa (calculated). |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
SELENBP1 Recombinant Protein (Rat) |
RP227957 |
ABM |
100 ug |
Ask for price |
SELENBP1 Recombinant Protein (Mouse) |
RP170645 |
ABM |
100 ug |
Ask for price |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human SELENBP1 shRNA Plasmid |
20-abx955932 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit |
EG3801-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit |
EG3811-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Canine Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit |
ECR3005-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit |
EMR3005-1 |
AssayPro |
96 Well Plate |
EUR 417 |
SELENBP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2115402 |
ABM |
1.0 ug DNA |
EUR 154 |
SELENBP1 Conjugated Antibody |
C38221 |
SAB |
100ul |
EUR 397 |
SELENBP1 cloning plasmid |
CSB-CL618766HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1419
- Sequence: atggctacgaaatgtgggaattgtggacccggctactccacccctctggaggccatgaaaggacccagggaagagatcgtctacctgccctgcatttaccgaaacacaggcactgaggccccagattatctggccactgtggatgttgaccccaagtctccccagtattgccagg
- Show more
|
Description: A cloning plasmid for the SELENBP1 gene. |
Mouse Selenbp1 Antibody |
abx030957-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mouse Selenbp1 Antibody |
abx030957-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
SELENBP1 Blocking Peptide |
33R-4604 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SELENBP1 antibody, catalog no. 70R-3071 |
SELENBP1 Blocking Peptide |
33R-5778 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SELENBP1 antibody, catalog no. 70R-2556 |
SELENBP1 Blocking Peptide |
DF6354-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-SELENBP1 antibody |
STJ25468 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: This gene encodes a member of the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. The effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins, and decreased expression of this gene may be associated with several types of cancer. The encoded protein may play a selenium-dependent role in ubiquitination/deubiquitination-mediated protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
AZGP1 Alpha-2-Glycoprotein 1 Zinc-Binding Human Recombinant Protein |
PROTP25311-1 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: AZGP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (21-298 a.a) and having a molecular mass of 34.5kDa.;AZGP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
ELISA kit for Human O-phosphoseryl-tRNA (Sec) selenium transferase |
EK2630 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human O-phosphoseryl-tRNA (Sec) selenium transferase in samples from serum, plasma, tissue homogenates and other biological fluids. |
TARDBP (1-414) Human, TAR DNA Binding Protein (1-414 a.a.) Human Recombinant Protein, His Tag |
PROTQ13148-1 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: TARDBP Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 450 amino acids (1-414 a.a) and having a total molecular mass of 48.8 kDa. TARDBP is fused to a 36 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
SELENBP1 ORF Vector (Human) (pORF) |
ORF009317 |
ABM |
1.0 ug DNA |
EUR 95 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Human TANK-binding kinase 1-binding protein 1 (TBKBP1) ELISA Kit |
abx385467-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human UL16 Binding protein 1 ELISA kit |
E01U0022-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human UL16 Binding protein 1 ELISA kit |
E01U0022-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human UL16 Binding protein 1 ELISA kit |
E01U0022-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Calcineurin Binding Protein 1 ELISA kit |
E01C0536-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Calcineurin Binding Protein 1 ELISA kit |
E01C0536-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Calcineurin Binding Protein 1 ELISA kit |
E01C0536-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human GATA Binding Protein 1 ELISA kit |
E01G0084-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human GATA Binding Protein 1 ELISA kit |
E01G0084-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human GATA Binding Protein 1 ELISA kit |
E01G0084-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hyaluronan Binding Protein 1 ELISA kit |
E01H0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hyaluronan Binding Protein 1 ELISA kit |
E01H0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hyaluronan Binding Protein 1 ELISA kit |
E01H0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Hyaluronan Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
SELENBP1 Protein Vector (Human) (pPB-C-His) |
PV037265 |
ABM |
500 ng |
EUR 329 |
SELENBP1 Protein Vector (Human) (pPB-N-His) |
PV037266 |
ABM |
500 ng |
EUR 329 |
SELENBP1 Protein Vector (Human) (pPM-C-HA) |
PV037267 |
ABM |
500 ng |
EUR 329 |
SELENBP1 Protein Vector (Human) (pPM-C-His) |
PV037268 |
ABM |
500 ng |
EUR 329 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
ULBP4 UL16 Binding Protein 4 Human Recombinant Protein |
PROTQ8TD07-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: ULBP4 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Isoform 3 of Q8TD07) containing 192 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 22kDa. |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit |
EH5215-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
IL18BP Human, Interleukin-18 Binding Protein Human Recombinant Protein, Sf9 |
PROTO95998-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: IL18BP Human Recombinant produced in Sf9 Baculovirus cells is a single, non-glycosylated polypeptide chain containing 406 amino acids (31-194a.a) and having a molecular mass of 44.9kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). IL18BP is fused to a 239 amino acid hIgG-His-tag at C-terminus & purified by proprietary chromatographic techniques. |
ULBP2 Human, UL16 Binding Protein 2 Human Recombinant Protein, Sf9 |
PROTQ9BZM5-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: ULBP2 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216a.a) and having a molecular mass of 22.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). ULBP2 is fused to a 9 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Rat SELENBP1 shRNA Plasmid |
20-abx987541 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse SELENBP1 shRNA Plasmid |
20-abx972630 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
S100b S100 Calcium Binding Protein B Human Recombinant Protein |
PROTP04271-1 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: S100b Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 92 amino acids (1-92 a.a.) and having a molecular mass of 10.7kDa.; The S100b is purified by proprietary chromatographic techniques. |
S100A8 S100 Calcium Binding Protein A8 Human Recombinant Protein |
PROTP05109-1 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: S100A8 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 93 amino acids (1-93 a.a.) and having a molecular mass of 10.8 kDa. The S100A8 is purified by proprietary chromatographic techniques. |
FABP2 Fatty Acid Binding Protein-2 Human Recombinant Protein |
PROTP12104-1 |
BosterBio |
Regular: 25ug |
EUR 317 |
Description: FABP2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 131 amino acids and having a molecular mass of 15.1kDa.;The FABP2 is purified by proprietary chromatographic techniques. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Human AE Binding Protein 1 (AEBP1) ELISA Kit |
abx520682-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Retinol-binding protein 1 (RBP1) ELISA Kit |
abx570744-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit |
abx571045-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human AE Binding Protein 1 (AEBP1) ELISA Kit |
abx572539-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human X Box Binding Protein 1 ELISA kit |
E01X0002-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human X Box Binding Protein 1 ELISA kit |
E01X0002-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human X Box Binding Protein 1 ELISA kit |
E01X0002-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human X Box Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Calcium binding protein 1(CABP1) ELISA kit |
E01C1297-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Calcium binding protein 1(CABP1) ELISA kit |
E01C1297-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Calcium binding protein 1(CABP1) ELISA kit |
E01C1297-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Calcium binding protein 1(CABP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Actin binding LIM protein 1 ELISA kit |
E01A0983-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Actin binding LIM protein 1 ELISA kit |
E01A0983-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Actin binding LIM protein 1 ELISA kit |
E01A0983-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Actin binding LIM protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Syntaxin binding protein 1(STXBP1) ELISA kit |
E01S0420-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Syntaxin binding protein 1(STXBP1) ELISA kit |
E01S0420-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Syntaxin binding protein 1(STXBP1) ELISA kit |
E01S0420-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Syntaxin binding protein 1(STXBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Heme binding protein 1(HEBP1) ELISA kit |
E01H1367-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Heme binding protein 1(HEBP1) ELISA kit |
E01H1367-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Heme binding protein 1(HEBP1) ELISA kit |
E01H1367-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Heme binding protein 1(HEBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Ribosome-binding protein 1 |
EK2696 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ribosome-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Retinol-binding protein 1 |
EK2963 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Retinol-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Phosphatidylethanolamine-binding protein 1 |
EK3100 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phosphatidylethanolamine-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human HSPBP1(Hsp70-binding protein 1) ELISA Kit |
EH4917 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.313-20 ng/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human PEBP1/ Phosphatidylethanolamine-binding protein 1 ELISA Kit |
E1903Hu |
Sunlong |
1 Kit |
EUR 605 |
Human RRBP1/ Ribosome-binding protein 1 ELISA Kit |
E2178Hu |
Sunlong |
1 Kit |
EUR 605 |
Human RBP1/ Retinol-binding protein 1 ELISA Kit |
E2832Hu |
Sunlong |
1 Kit |
EUR 571 |
Human RRBP1(Ribosome-binding protein 1) ELISA Kit |
EH1215 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q9P2E9
- Alias: RRBP1/Ribosome-binding protein 1/Ribosome receptor protein/180 kDa ribosome receptor homolog/RRp
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Human STXBP1(Syntaxin-binding protein 1) ELISA Kit |
EH12697 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Alias: EIEE4/ MUNC18 1/ N Sec1/ p67/ Protein unc 18 homolog 1/ Protein unc 18 homolog A/ RBSEC1/ STXBP1/ syntaxin binding protein 1/ Unc 18A/ UNC18/ Unc18 1/ UNC18A
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human RBP1(Retinol-binding protein 1) ELISA Kit |
EH1381 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P09455
- Alias: RBP1(Retinol Binding Protein 1, Cellular)/Retinol-binding protein 1/Cellular retinol-binding protein/CRBP/Cellular retinol-binding protein I/CRBP-I
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human PEBP1(Phosphatidylethanolamine-binding protein 1) ELISA Kit |
EH1445 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P30086
- Alias: PEBP1/HCNPpp/Neuropolypeptide h3/PBP/PEBP-1/HCNP/hippocampal cholinergic neurostimulating peptide/Neuropolypeptide h3/phosphatidylethanolamine binding protein 1/prostatic binding protein/Prost
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Polyadenylate- binding protein 1, PABPC1 ELISA KIT |
ELI-12384h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Hsp70- binding protein 1, HSPBP1 ELISA KIT |
ELI-13077h |
Lifescience Market |
96 Tests |
EUR 824 |
Human SH3KBP1- binding protein 1, SHKBP1 ELISA KIT |
ELI-13606h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Ribosome- binding protein 1, RRBP1 ELISA KIT |
ELI-18387h |
Lifescience Market |
96 Tests |
EUR 824 |
Human RalA- binding protein 1, RALBP1 ELISA KIT |
ELI-22544h |
Lifescience Market |
96 Tests |
EUR 824 |
Human NEDD4- binding protein 1, N4BP1 ELISA KIT |
ELI-22852h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Retinol- binding protein 1, RBP1 ELISA KIT |
ELI-04010h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Formin- binding protein 1, FNBP1 ELISA KIT |
ELI-07787h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Oxysterol- binding protein 1, OSBP ELISA KIT |
ELI-35189h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Heme- binding protein 1, HEBP1 ELISA KIT |
ELI-43925h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Retinaldehyde- binding protein 1, RLBP1 ELISA KIT |
ELI-44948h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Polyglutamine- binding protein 1, PQBP1 ELISA KIT |
ELI-45429h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Mis18- binding protein 1, MIS18BP1 ELISA KIT |
ELI-46264h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Syntaxin- binding protein 1, STXBP1 ELISA KIT |
ELI-29278h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Tax1- binding protein 1, TAX1BP1 ELISA KIT |
ELI-29735h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Upstream- binding protein 1, UBP1 ELISA KIT |
ELI-39972h |
Lifescience Market |
96 Tests |
EUR 824 |
Human GTP- binding protein 1, GTPBP1 ELISA KIT |
ELI-48517h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Immunoglobulin- binding protein 1, IGBP1 ELISA KIT |
ELI-48699h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Calcium- binding protein 1, CABP1 ELISA KIT |
ELI-50448h |
Lifescience Market |
96 Tests |
EUR 824 |
Human UHRF1- binding protein 1, UHRF1BP1 ELISA KIT |
ELI-51372h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Immunoglobulin Binding Protein 1 (IGBP1) ELISA Kit |
20-abx156788 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Retinaldehyde Binding Protein 1 (RLBP1) ELISA Kit |
20-abx156824 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Guanylate Binding Protein 1 (GBP1) ELISA Kit |
20-abx156886 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human AE Binding Protein 1 (AEBP1) ELISA Kit |
20-abx150582 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Formin Binding Protein 1 (FNBP1) ELISA Kit |
20-abx151573 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Phosphatidylethanolamine Binding Protein 1 (PEBP1) ELISA Kit |
20-abx152693 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human RalA Binding Protein 1 (RALBP1) ELISA Kit |
20-abx152919 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Polyadenylate-Binding Protein 1 (PABPC1) ELISA Kit |
abx259760-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human GATA Binding Protein 1 (GATA1) ELISA Kit |
abx351494-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Oxysterol Binding Protein 1 (OSBP) ELISA Kit |
abx381983-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human PPFIA Binding Protein 1 (PPFIBP1) ELISA Kit |
abx382388-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Polyglutamine-binding protein 1 (PQBP1) ELISA Kit |
abx382444-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human SET Binding Protein 1 (SETBP1) ELISA Kit |
abx383123-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human SH3KBP1-binding protein 1 (SHKBP1) ELISA Kit |
abx383189-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human SELENBP1(Selenium Binding Protein 1) ELISA Kit