Human REPIN1(Replication Initiator 1) ELISA Kit

Human REPIN1(Replication Initiator 1) ELISA Kit

Human Replication Initiator 1 (REPIN1) ELISA Kit

RD-REPIN1-Hu-48Tests 48 Tests
EUR 521

Human Replication Initiator 1 (REPIN1) ELISA Kit

RD-REPIN1-Hu-96Tests 96 Tests
EUR 723

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

DLR-REPIN1-Mu-48T 48T
EUR 527
  • Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

DLR-REPIN1-Mu-96T 96T
EUR 688
  • Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

RDR-REPIN1-Mu-48Tests 48 Tests
EUR 557

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

RDR-REPIN1-Mu-96Tests 96 Tests
EUR 774

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

RD-REPIN1-Mu-48Tests 48 Tests
EUR 533

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

RD-REPIN1-Mu-96Tests 96 Tests
EUR 740

Human Replication Initiator 1 (REPIN1)ELISA Kit

201-12-2402 96 tests
EUR 440
  • This Replication Initiator 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit

20-abx152951
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Replication Initiator 1 (REPIN1) ELISA Kit

abx253102-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human REPIN1(Replication Initiator 1) ELISA Kit

EH3712 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9BWE0
  • Alias: REPIN1/Zinc finger protein 464/DHFR oribeta-binding protein RIP60/ATT-binding protein/60 kDa origin-specific DNA-binding protein/60 kDa replication initiation region protein/RIP60/ZNF464
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Replication initiator 1, REPIN1 ELISA KIT

ELI-14616h 96 Tests
EUR 824

Human Replication Initiator 1(REPIN1)ELISA Kit

QY-E03529 96T
EUR 361

Human Replication Initiator 1 (REPIN1) ELISA Kit

SEG516Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit

SEG516Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit

SEG516Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit

SEG516Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit

4-SEG516Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4
  • RIP60
  • ZNF464
  • Zfp464
  • Replication Initiation Region Protein(60kD)
  • Zinc Finger Protein 464
  • 60 kDa origin-specific DNA-binding protein
  • ATT-binding protei
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Replication Initiator 1 (REPIN1) Antibody

20-abx178249
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Replication Initiator 1 (REPIN1) Antibody

20-abx129189
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Replication Initiator 1 (REPIN1) Antibody

20-abx129904
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Replication Initiator 1 (REPIN1) Antibody

20-abx174377
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Replication Initiator 1 (REPIN1)

4-RPG516Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9BWE0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Replication Initiator 1 expressed in: E.coli

Recombinant Replication Initiator 1 (REPIN1)

4-RPG516Mu01
  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5U4E2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Replication Initiator 1 expressed in: E.coli

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

20-abx154614
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Bovine Replication initiator 1, REPIN1 ELISA KIT

ELI-52607b 96 Tests
EUR 928

Mouse Replication initiator 1, Repin1 ELISA KIT

ELI-44355m 96 Tests
EUR 865

Rat Replication Initiator 1 (REPIN1) ELISA Kit

abx391903-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Replication Initiator 1(REPIN1)ELISA Kit

QY-E10499 96T
EUR 361

Mouse Replication Initiator 1(REPIN1)ELISA Kit

QY-E21317 96T
EUR 361

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

SEG516Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

SEG516Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

SEG516Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

SEG516Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit

4-SEG516Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4
  • RIP60
  • ZNF464
  • Zfp464
  • Replication Initiation Region Protein(60kD)
  • Zinc Finger Protein 464
  • 60 kDa origin-specific DNA-binding protein
  • ATT-binding protei
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Replication Initiator 1 (REPIN1) Protein

20-abx168192
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Replication Initiator 1 (REPIN1) CLIA Kit

abx195148-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Replication Initiator 1 (REPIN1) CLIA Kit

20-abx495229
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human REPIN1 (Replication Initiator 1)

E-EL-H1760 1 plate of 96 wells
EUR 534
  • Gentaur's REPIN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human REPIN1 (Replication Initiator 1)

ELK3776 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R
  • Show more
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)

KTE60806-48T 48T
EUR 332
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)

KTE60806-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)

KTE60806-96T 96T
EUR 539
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) Protein

20-abx168411
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Replication Initiator 1 (REPIN1) CLIA Kit

20-abx495230
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse REPIN1 (Replication Initiator 1)

ELK6478 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R
  • Show more
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)

KTE70507-48T 48T
EUR 332
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)

KTE70507-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)

KTE70507-96T 96T
EUR 539
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human)

4-PAG516Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1)

CLIA kit for Human REPIN1 (Replication Initiator 1)

E-CL-H1102 1 plate of 96 wells
EUR 584
  • Gentaur's REPIN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1 . Standards or samples are added to the micro CLIA plate wells and combined with
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant

Repin1 ELISA Kit| Rat Replication initiator 1 ELISA Kit

EF019263 96 Tests
EUR 689

Repin1 ELISA Kit| Mouse Replication initiator 1 ELISA Kit

EF016079 96 Tests
EUR 689

REPIN1 ELISA Kit| Bovine Replication initiator 1 ELISA Kit

EF011851 96 Tests
EUR 689

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse)

4-PAG516Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1)

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC

4-PAG516Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Biotinylated

4-PAG516Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Cy3

4-PAG516Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), FITC

4-PAG516Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), HRP

4-PAG516Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), PE

4-PAG516Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with PE.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC

4-PAG516Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Biotinylated

4-PAG516Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Cy3

4-PAG516Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), FITC

4-PAG516Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), HRP

4-PAG516Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), PE

4-PAG516Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with PE.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC-Cy7

4-PAG516Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAG516Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.

Recombinant human Replication initiator 1

P2526 100ug Ask for price
  • Uniprot ID: Q9BWE0
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Replication initiator 1

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Repin1/ Rat Repin1 ELISA Kit

ELI-19261r 96 Tests
EUR 886

REPIN1 ELISA KIT|Human

EF007143 96 Tests
EUR 689

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

REPIN1 siRNA

20-abx904532
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

REPIN1 siRNA

20-abx931266
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

REPIN1 siRNA

20-abx931267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-REPIN1

PVT18357 2 ug
EUR 231

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Replication Factor C Subunit 1 (RFC1) ELISA Kit

abx257525-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Replication factor C subunit 1, RFC1 ELISA KIT

ELI-21926h 96 Tests
EUR 824

Human REPIN1 shRNA Plasmid

20-abx959235
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

REPIN1 Recombinant Protein (Human)

RP026188 100 ug Ask for price

REPIN1 Recombinant Protein (Human)

RP026191 100 ug Ask for price

Human Replication Protein A1 (RPA1) ELISA Kit

DLR-RPA1-Hu-48T 48T
EUR 517
  • Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

DLR-RPA1-Hu-96T 96T
EUR 673
  • Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

20-abx152981
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Replication Protein A2 (RPA2) ELISA Kit

abx382883-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Replication Protein A3 (RPA3) ELISA Kit

abx382884-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit

abx573009-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit

RDR-RPA1-Hu-48Tests 48 Tests
EUR 544

Human Replication Protein A1 (RPA1) ELISA Kit

RDR-RPA1-Hu-96Tests 96 Tests
EUR 756

Human Replication Protein A1 (RPA1) ELISA Kit

RD-RPA1-Hu-48Tests 48 Tests
EUR 521

Human Replication Protein A1 (RPA1) ELISA Kit

RD-RPA1-Hu-96Tests 96 Tests
EUR 723

Human Replication Protein A1 (RPA1) ELISA Kit

SEH217Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

SEH217Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

SEH217Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

SEH217Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit

4-SEH217Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB
  • REPA1
  • RF-A
  • RP-A
  • RPA70
  • Replication protein A 70 kDa DNA-binding subunit
  • Single-stranded DNA-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Protein A1 (RPA1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

REPIN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1809002 1.0 ug DNA
EUR 154

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Replication Protein A2 (RPA2) ELISA Kit

abx595526-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

REPIN1 cloning plasmid

CSB-CL019564HU1-10ug 10ug
EUR 587
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct
  • Show more
Description: A cloning plasmid for the REPIN1 gene.

REPIN1 cloning plasmid

CSB-CL019564HU2-10ug 10ug
EUR 587
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct
  • Show more
Description: A cloning plasmid for the REPIN1 gene.

REPIN1 Rabbit pAb

A18451-100ul 100 ul
EUR 308

REPIN1 Rabbit pAb

A18451-200ul 200 ul
EUR 459

REPIN1 Rabbit pAb

A18451-20ul 20 ul
EUR 183

REPIN1 Rabbit pAb

A18451-50ul 50 ul
EUR 223

pOTB7-REPIN1-2

PVT18946 2 ug
EUR 231

Anti-REPIN1 antibody

STJ11100405 100 µl
EUR 277

Mouse Replication factor C subunit 1, Rfc1 ELISA KIT

ELI-14393m 96 Tests
EUR 865

Human replication protein A,RPA-70 ELISA Kit

201-12-1914 96 tests
EUR 440
  • This replication protein A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human RPA1 (Replication protein A1)

E-EL-H1282 1 plate of 96 wells
EUR 534
  • Gentaur's RPA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RPA1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RPA1 (Replication protein A1) in samples from Serum, Plasma, Cell supernatant

Human CDT1/ DNA replication factor Cdt1 ELISA Kit

E0465Hu 1 Kit
EUR 605

Human DNA replication licensing factor MCM3 ELISA kit

E01D0531-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA replication licensing factor MCM3 ELISA kit

E01D0531-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA replication licensing factor MCM3 ELISA kit

E01D0531-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Replication Factor CDT1 (CDT1) ELISA Kit

abx250847-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Human DNA replication factor Cdt1

EK3329 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human DNA replication factor Cdt1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CDT1(DNA replication factor Cdt1) ELISA Kit

EH1559 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q9H211
  • Alias: CDT1/DNA replication factor Cdt1/Double parked homolog/DUP/RIS2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75 pg/ml

ELISA kit for Human RPA1 (Replication Protein A1)

ELK4413 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Protein A1 (RPA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Repl
  • Show more
Description: A sandwich ELISA kit for detection of Replication Protein A1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human replication protein A,RPA-70 ELISA Kit

CN-04330H1 96T
EUR 449

Human REPIN1(Replication Initiator 1) ELISA Kit