Human REPIN1(Replication Initiator 1) ELISA Kit
Human Replication Initiator 1 (REPIN1) ELISA Kit |
RD-REPIN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Replication Initiator 1 (REPIN1) ELISA Kit |
RD-REPIN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
DLR-REPIN1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids. |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
DLR-REPIN1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids. |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
RDR-REPIN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
RDR-REPIN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
RD-REPIN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
RD-REPIN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Replication Initiator 1 (REPIN1)ELISA Kit |
201-12-2402 |
SunredBio |
96 tests |
EUR 440 |
- This Replication Initiator 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Replication Initiator 1 (REPIN1) ELISA Kit |
20-abx152951 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Replication Initiator 1 (REPIN1) ELISA Kit |
abx253102-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human REPIN1(Replication Initiator 1) ELISA Kit |
EH3712 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q9BWE0
- Alias: REPIN1/Zinc finger protein 464/DHFR oribeta-binding protein RIP60/ATT-binding protein/60 kDa origin-specific DNA-binding protein/60 kDa replication initiation region protein/RIP60/ZNF464
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Replication initiator 1, REPIN1 ELISA KIT |
ELI-14616h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Replication Initiator 1 (REPIN1) ELISA Kit |
SEG516Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids. |
Human Replication Initiator 1 (REPIN1) ELISA Kit |
SEG516Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids. |
Human Replication Initiator 1 (REPIN1) ELISA Kit |
SEG516Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids. |
Human Replication Initiator 1 (REPIN1) ELISA Kit |
SEG516Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids. |
Human Replication Initiator 1 (REPIN1) ELISA Kit |
4-SEG516Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4
- RIP60
- ZNF464
- Zfp464
- Replication Initiation Region Protein(60kD)
- Zinc Finger Protein 464
- 60 kDa origin-specific DNA-binding protein
- ATT-binding protei
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Replication Initiator 1 (REPIN1) Antibody |
20-abx178249 |
Abbexa |
|
|
|
Replication Initiator 1 (REPIN1) Antibody |
20-abx129189 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Replication Initiator 1 (REPIN1) Antibody |
20-abx129904 |
Abbexa |
-
EUR 314.00
-
EUR 133.00
-
EUR 829.00
-
EUR 439.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Replication Initiator 1 (REPIN1) Antibody |
20-abx174377 |
Abbexa |
|
|
|
Recombinant Replication Initiator 1 (REPIN1) |
4-RPG516Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9BWE0
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 33.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Replication Initiator 1 expressed in: E.coli |
Recombinant Replication Initiator 1 (REPIN1) |
4-RPG516Mu01 |
Cloud-Clone |
-
EUR 501.41
-
EUR 237.00
-
EUR 1605.28
-
EUR 601.76
-
EUR 1103.52
-
EUR 398.00
-
EUR 3863.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q5U4E2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Replication Initiator 1 expressed in: E.coli |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
20-abx154614 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Bovine Replication initiator 1, REPIN1 ELISA KIT |
ELI-52607b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Replication initiator 1, Repin1 ELISA KIT |
ELI-44355m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat Replication Initiator 1 (REPIN1) ELISA Kit |
abx391903-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
SEG516Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids. |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
SEG516Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids. |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
SEG516Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids. |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
SEG516Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids. |
Mouse Replication Initiator 1 (REPIN1) ELISA Kit |
4-SEG516Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4
- RIP60
- ZNF464
- Zfp464
- Replication Initiation Region Protein(60kD)
- Zinc Finger Protein 464
- 60 kDa origin-specific DNA-binding protein
- ATT-binding protei
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Replication Initiator 1 (REPIN1) Protein |
20-abx168192 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Replication Initiator 1 (REPIN1) CLIA Kit |
abx195148-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Replication Initiator 1 (REPIN1) CLIA Kit |
20-abx495229 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human REPIN1 (Replication Initiator 1) |
E-EL-H1760 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's REPIN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1. Standards or samples are added to the micro ELISA plate wells and combined wit
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human REPIN1 (Replication Initiator 1) |
ELK3776 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R
- Show more
|
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Replication initiator 1 (REPIN1) |
KTE60806-48T |
Abbkine |
48T |
EUR 332 |
- Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Replication initiator 1 (REPIN1) |
KTE60806-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Replication initiator 1 (REPIN1) |
KTE60806-96T |
Abbkine |
96T |
EUR 539 |
- Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Replication Initiator 1 (REPIN1) Protein |
20-abx168411 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Replication Initiator 1 (REPIN1) CLIA Kit |
20-abx495230 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Mouse REPIN1 (Replication Initiator 1) |
ELK6478 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R
- Show more
|
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Replication initiator 1 (REPIN1) |
KTE70507-48T |
Abbkine |
48T |
EUR 332 |
- Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Replication initiator 1 (REPIN1) |
KTE70507-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Replication initiator 1 (REPIN1) |
KTE70507-96T |
Abbkine |
96T |
EUR 539 |
- Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human) |
4-PAG516Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (His57~His314)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1) |
CLIA kit for Human REPIN1 (Replication Initiator 1) |
E-CL-H1102 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's REPIN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1 . Standards or samples are added to the micro CLIA plate wells and combined with
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant |
Repin1 ELISA Kit| Rat Replication initiator 1 ELISA Kit |
EF019263 |
Lifescience Market |
96 Tests |
EUR 689 |
Repin1 ELISA Kit| Mouse Replication initiator 1 ELISA Kit |
EF016079 |
Lifescience Market |
96 Tests |
EUR 689 |
REPIN1 ELISA Kit| Bovine Replication initiator 1 ELISA Kit |
EF011851 |
Lifescience Market |
96 Tests |
EUR 689 |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse) |
4-PAG516Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (Pro30~Pro298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1) |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC |
4-PAG516Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (His57~His314)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Biotinylated |
4-PAG516Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (His57~His314)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Cy3 |
4-PAG516Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (His57~His314)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), FITC |
4-PAG516Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (His57~His314)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with FITC. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), HRP |
4-PAG516Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (His57~His314)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with HRP. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), PE |
4-PAG516Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (His57~His314)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with PE. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC |
4-PAG516Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (Pro30~Pro298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAG516Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (Pro30~Pro298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Cy3 |
4-PAG516Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (Pro30~Pro298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), FITC |
4-PAG516Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (Pro30~Pro298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with FITC. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), HRP |
4-PAG516Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (Pro30~Pro298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with HRP. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), PE |
4-PAG516Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (Pro30~Pro298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with PE. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAG516Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (His57~His314)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7. |
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAG516Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: REPIN1 (Pro30~Pro298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7. |
Recombinant human Replication initiator 1 |
P2526 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q9BWE0
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Replication initiator 1 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
REPIN1 siRNA |
20-abx904532 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
REPIN1 siRNA |
20-abx931266 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
REPIN1 siRNA |
20-abx931267 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human Replication Factor C Subunit 1 (RFC1) ELISA Kit |
abx257525-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human Replication factor C subunit 1, RFC1 ELISA KIT |
ELI-21926h |
Lifescience Market |
96 Tests |
EUR 824 |
Human REPIN1 shRNA Plasmid |
20-abx959235 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
REPIN1 Recombinant Protein (Human) |
RP026188 |
ABM |
100 ug |
Ask for price |
REPIN1 Recombinant Protein (Human) |
RP026191 |
ABM |
100 ug |
Ask for price |
Human Replication Protein A1 (RPA1) ELISA Kit |
DLR-RPA1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
DLR-RPA1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
20-abx152981 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Replication Protein A2 (RPA2) ELISA Kit |
abx382883-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Replication Protein A3 (RPA3) ELISA Kit |
abx382884-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Replication Protein A1 (RPA1) ELISA Kit |
abx573009-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Replication Protein A1 (RPA1) ELISA Kit |
RDR-RPA1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Replication Protein A1 (RPA1) ELISA Kit |
RDR-RPA1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Replication Protein A1 (RPA1) ELISA Kit |
RD-RPA1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Replication Protein A1 (RPA1) ELISA Kit |
RD-RPA1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Replication Protein A1 (RPA1) ELISA Kit |
SEH217Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
SEH217Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
SEH217Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
SEH217Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids. |
Human Replication Protein A1 (RPA1) ELISA Kit |
4-SEH217Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB
- REPA1
- RF-A
- RP-A
- RPA70
- Replication protein A 70 kDa DNA-binding subunit
- Single-stranded DNA-binding protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Protein A1 (RPA1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
REPIN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1809002 |
ABM |
1.0 ug DNA |
EUR 154 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Replication Protein A2 (RPA2) ELISA Kit |
abx595526-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
REPIN1 cloning plasmid |
CSB-CL019564HU1-10ug |
Cusabio |
10ug |
EUR 587 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1704
- Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct
- Show more
|
Description: A cloning plasmid for the REPIN1 gene. |
REPIN1 cloning plasmid |
CSB-CL019564HU2-10ug |
Cusabio |
10ug |
EUR 587 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1704
- Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct
- Show more
|
Description: A cloning plasmid for the REPIN1 gene. |
REPIN1 Rabbit pAb |
A18451-100ul |
Abclonal |
100 ul |
EUR 308 |
REPIN1 Rabbit pAb |
A18451-200ul |
Abclonal |
200 ul |
EUR 459 |
REPIN1 Rabbit pAb |
A18451-20ul |
Abclonal |
20 ul |
EUR 183 |
REPIN1 Rabbit pAb |
A18451-50ul |
Abclonal |
50 ul |
EUR 223 |
Mouse Replication factor C subunit 1, Rfc1 ELISA KIT |
ELI-14393m |
Lifescience Market |
96 Tests |
EUR 865 |
Human replication protein A,RPA-70 ELISA Kit |
201-12-1914 |
SunredBio |
96 tests |
EUR 440 |
- This replication protein A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA kit for Human RPA1 (Replication protein A1) |
E-EL-H1282 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's RPA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RPA1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human RPA1 (Replication protein A1) in samples from Serum, Plasma, Cell supernatant |
Human CDT1/ DNA replication factor Cdt1 ELISA Kit |
E0465Hu |
Sunlong |
1 Kit |
EUR 605 |
Human DNA replication licensing factor MCM3 ELISA kit |
E01D0531-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DNA replication licensing factor MCM3 ELISA kit |
E01D0531-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DNA replication licensing factor MCM3 ELISA kit |
E01D0531-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DNA Replication Factor CDT1 (CDT1) ELISA Kit |
abx250847-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Human DNA replication factor Cdt1 |
EK3329 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human DNA replication factor Cdt1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human CDT1(DNA replication factor Cdt1) ELISA Kit |
EH1559 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: Q9H211
- Alias: CDT1/DNA replication factor Cdt1/Double parked homolog/DUP/RIS2
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75 pg/ml |
ELISA kit for Human RPA1 (Replication Protein A1) |
ELK4413 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Protein A1 (RPA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Repl
- Show more
|
Description: A sandwich ELISA kit for detection of Replication Protein A1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human replication protein A,RPA-70 ELISA Kit |
CN-04330H1 |
ChemNorm |
96T |
EUR 449 |
Human REPIN1(Replication Initiator 1) ELISA Kit