Human REPIN1(Replication Initiator 1) ELISA Kit

Human REPIN1(Replication Initiator 1) ELISA Kit

Human Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
DLR-REPIN1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
DLR-REPIN1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human REPIN1(Replication Initiator 1) ELISA Kit
EH3712	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q9BWE0 Alias: REPIN1/Zinc finger protein 464/DHFR oribeta-binding protein RIP60/ATT-binding protein/60 kDa origin-specific DNA-binding protein/60 kDa replication initiation region protein/RIP60/ZNF464
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Replication initiator 1, REPIN1 ELISA KIT
ELI-14616h	Lifescience Market	96 Tests	EUR 824

Human Replication Initiator 1 (REPIN1) ELISA Kit
20-abx152951	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Replication Initiator 1 (REPIN1) ELISA Kit
abx253102-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Replication Initiator 1 (REPIN1)ELISA Kit
201-12-2402	SunredBio	96 tests	EUR 440
This Replication Initiator 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Replication Initiator 1(REPIN1)ELISA Kit
QY-E03529	Qayee Biotechnology	96T	EUR 361

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
4-SEG516Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4 RIP60 ZNF464 Zfp464 Replication Initiation Region Protein(60kD) Zinc Finger Protein 464 60 kDa origin-specific DNA-binding protein ATT-binding protei Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Replication Initiator 1 (REPIN1) Antibody
20-abx129189	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Replication Initiator 1 (REPIN1) Antibody
20-abx129904	Abbexa	EUR 314.00 EUR 133.00 EUR 829.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Replication Initiator 1 (REPIN1) Antibody
20-abx174377	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Replication Initiator 1 (REPIN1) Antibody
20-abx178249	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Recombinant Replication Initiator 1 (REPIN1)
4-RPG516Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9BWE0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Replication Initiator 1 expressed in: E.coli

Recombinant Replication Initiator 1 (REPIN1)
4-RPG516Mu01	Cloud-Clone	EUR 501.41 EUR 237.00 EUR 1605.28 EUR 601.76 EUR 1103.52 EUR 398.00 EUR 3863.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q5U4E2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.6kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Replication Initiator 1 expressed in: E.coli

Human Replication Initiator 1 (REPIN1) Protein
20-abx168192	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Bovine Replication initiator 1, REPIN1 ELISA KIT
ELI-52607b	Lifescience Market	96 Tests	EUR 928

Mouse Replication initiator 1, Repin1 ELISA KIT
ELI-44355m	Lifescience Market	96 Tests	EUR 865

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
20-abx154614	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Replication Initiator 1 (REPIN1) ELISA Kit
abx391903-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Replication Initiator 1(REPIN1)ELISA Kit
QY-E10499	Qayee Biotechnology	96T	EUR 361

Mouse Replication Initiator 1(REPIN1)ELISA Kit
QY-E21317	Qayee Biotechnology	96T	EUR 361

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
4-SEG516Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4 RIP60 ZNF464 Zfp464 Replication Initiation Region Protein(60kD) Zinc Finger Protein 464 60 kDa origin-specific DNA-binding protein ATT-binding protei Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Replication Initiator 1 (REPIN1) CLIA Kit
abx195148-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Replication Initiator 1 (REPIN1) CLIA Kit
20-abx495229	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human REPIN1 (Replication Initiator 1)
E-EL-H1760	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's REPIN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human REPIN1 (Replication Initiator 1)
ELK3776	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R Show more
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-48T	Abbkine	48T	EUR 332
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-96T	Abbkine	96T	EUR 539
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) Protein
20-abx168411	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Replication Initiator 1 (REPIN1) CLIA Kit
20-abx495230	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse REPIN1 (Replication Initiator 1)
ELK6478	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R Show more
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-48T	Abbkine	48T	EUR 332
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-96T	Abbkine	96T	EUR 539
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human)
4-PAG516Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1)

CLIA kit for Human REPIN1 (Replication Initiator 1)
E-CL-H1102	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's REPIN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1 . Standards or samples are added to the micro CLIA plate wells and combined with Show more
Description: A sandwich CLIA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant

Repin1 ELISA Kit| Rat Replication initiator 1 ELISA Kit
EF019263	Lifescience Market	96 Tests	EUR 689

Repin1 ELISA Kit| Mouse Replication initiator 1 ELISA Kit
EF016079	Lifescience Market	96 Tests	EUR 689

REPIN1 ELISA Kit| Bovine Replication initiator 1 ELISA Kit
EF011851	Lifescience Market	96 Tests	EUR 689

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse)
4-PAG516Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1)

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC
4-PAG516Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Biotinylated
4-PAG516Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Cy3
4-PAG516Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), FITC
4-PAG516Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), HRP
4-PAG516Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), PE
4-PAG516Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with PE.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC
4-PAG516Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Biotinylated
4-PAG516Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Cy3
4-PAG516Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), FITC
4-PAG516Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), HRP
4-PAG516Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), PE
4-PAG516Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with PE.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC-Cy7
4-PAG516Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG516Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.

Recombinant human Replication initiator 1
P2526	FN Test	100ug	Ask for price
Uniprot ID: Q9BWE0 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Replication initiator 1

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Repin1/ Rat Repin1 ELISA Kit
ELI-19261r	Lifescience Market	96 Tests	EUR 886

REPIN1 ELISA KIT|Human
EF007143	Lifescience Market	96 Tests	EUR 689

REPIN1 ELISA Kit (Human) (OKCD01920)
OKCD01920	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL

REPIN1 ELISA Kit (Mouse) (OKCD01001)
OKCD01001	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.135 ng/mL

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

REPIN1 siRNA
20-abx904532	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

REPIN1 siRNA
20-abx931266	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

REPIN1 siRNA
20-abx931267	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-REPIN1
PVT18357	Lifescience Market	2 ug	EUR 231

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human Replication factor C subunit 1, RFC1 ELISA KIT
ELI-21926h	Lifescience Market	96 Tests	EUR 824

Human Replication Factor C Subunit 1 (RFC1) ELISA Kit
abx257525-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human REPIN1 shRNA Plasmid
20-abx959235	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

REPIN1 Recombinant Protein (Human)
RP026188	ABM	100 ug	Ask for price

REPIN1 Recombinant Protein (Human)
RP026191	ABM	100 ug	Ask for price

Human Replication Protein A1 (RPA1) ELISA Kit
abx573009-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit
20-abx152981	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Replication Protein A2 (RPA2) ELISA Kit
abx382883-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Replication Protein A3 (RPA3) ELISA Kit
abx382884-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
4-SEH217Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB REPA1 RF-A RP-A RPA70 Replication protein A 70 kDa DNA-binding subunit Single-stranded DNA-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Protein A1 (RPA1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

REPIN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1809002	ABM	1.0 ug DNA	EUR 154

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

REPIN1 cloning plasmid
CSB-CL019564HU1-10ug	Cusabio	10ug	EUR 587
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1704 Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct Show more
Description: A cloning plasmid for the REPIN1 gene.

REPIN1 cloning plasmid
CSB-CL019564HU2-10ug	Cusabio	10ug	EUR 587
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1704 Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct Show more
Description: A cloning plasmid for the REPIN1 gene.

REPIN1 Rabbit pAb
A18451-100ul	Abclonal	100 ul	EUR 308

REPIN1 Rabbit pAb
A18451-200ul	Abclonal	200 ul	EUR 459

REPIN1 Rabbit pAb
A18451-20ul	Abclonal	20 ul	EUR 183

REPIN1 Rabbit pAb
A18451-50ul	Abclonal	50 ul	EUR 223

pOTB7-REPIN1-2
PVT18946	Lifescience Market	2 ug	EUR 231

Anti-REPIN1 antibody
STJ11100405	St John's Laboratory	100 µl	EUR 277

Replication Protein A2 (RPA2) ELISA Kit
abx595526-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Mouse Replication factor C subunit 1, Rfc1 ELISA KIT
ELI-14393m	Lifescience Market	96 Tests	EUR 865

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human CDT1/ DNA replication factor Cdt1 ELISA Kit
E0465Hu	Sunlong	1 Kit	EUR 605

Human DNA replication licensing factor MCM3 ELISA kit
E01D0531-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA replication licensing factor MCM3 ELISA kit
E01D0531-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA replication licensing factor MCM3 ELISA kit
E01D0531-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human DNA replication factor Cdt1
EK3329	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human DNA replication factor Cdt1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CDT1(DNA replication factor Cdt1) ELISA Kit
EH1559	FN Test	96T	EUR 567.6
Detection range: 31.25-2000 pg/ml Uniprot ID: Q9H211 Alias: CDT1/DNA replication factor Cdt1/Double parked homolog/DUP/RIS2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75 pg/ml

ELISA kit for Human RPA1 (Replication Protein A1)
ELK4413	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Protein A1 (RPA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Repl Show more
Description: A sandwich ELISA kit for detection of Replication Protein A1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human replication protein A(RPA-70)ELISA Kit
GA-E1930HM-48T	GenAsia Biotech	48T	EUR 289

Human REPIN1(Replication Initiator 1) ELISA Kit