Human QDPR(Quinoid Dihydropteridine Reductase) ELISA Kit

Human QDPR(Quinoid Dihydropteridine Reductase) ELISA Kit

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
RDR-QDPR-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
RDR-QDPR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
RD-QDPR-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
RD-QDPR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Quinoid Dihydropteridine Reductase (QDPR) Antibody
20-abx004384	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody
20-abx127024	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody
20-abx128258	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody
abx122140-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody
20-abx141790	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody
20-abx174324	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Quinoid Dihydropteridine Reductase (QDPR) Antibody
abx034130-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody
abx034130-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody
abx236982-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody
20-abx318177	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Quinoid Dihydropteridine Reductase (QDPR)
4-RPC758Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P09417 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.5kDa Isoelectric Point: 6.9
Description: Recombinant Human Quinoid Dihydropteridine Reductase expressed in: E.coli

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
20-abx152907	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
abx250962-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
abx571250-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
SEC758Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
SEC758Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
SEC758Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
SEC758Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
4-SEC758Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Quinoid Dihydropteridine Reductase elisa. Alternative names of the recognized antigen: DHPR PKU2 SDR33C1 HDHPR 6, 7-Dihydropteridine Reductase Short Chain Dehydrogenase/Reductase Family 33C, Member 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Quinoid Dihydropteridine Reductase (QDPR) Protein
20-abx166524	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cow Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
abx517175-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
abx517177-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Pig Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
abx517178-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit
abx517179-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Quinoid Dihydropteridine Reductase (QDPR) CLIA Kit
20-abx493885	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Quinoid Dihydropteridine Reductase (QDPR) Antibody (HRP)
20-abx305006	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody (FITC)
20-abx305007	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody (Biotin)
20-abx305008	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Human QDPR (Quinoid Dihydropteridine Reductase)
ELK3844	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Quinoid Dihydropteridine Reductase (QDPR). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of Quinoid Dihydropteridine Reductase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

QDPR Quinoid Dihydropteridine Reductase Human Recombinant Protein
PROTP09417	BosterBio	Regular: 20ug	EUR 317
Description: QDPR Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 267 amino acids (1-244 a.a.) and having a molecular mass of 28.2kDa.;QDPR is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig)
4-PAC758Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: QDPR (Met1~Phe244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR)

Quinoid Dihydropteridine Reductase Antibody
20-abx114950	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (Recombinant)
20-abx073542	Abbexa	EUR 4490.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Human QDPR/ Dihydropteridine reductase ELISA Kit
E2111Hu	Sunlong	1 Kit	EUR 605

Human QDPR(Dihydropteridine reductase) ELISA Kit
EH1666	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P09417 Alias: QDPR/DHPR/HDHPR/PKU2/SDR33C1/DHPR member 1/Dihydropteridine reductase/Quinoid Dihydropteridine Reductase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Dihydropteridine reductase, QDPR ELISA KIT
ELI-26300h	Lifescience Market	96 Tests	EUR 824

Recombinant Human Quinoid Dihydropteridine Reductase
7-03535	CHI Scientific	5µg	Ask for price

Recombinant Human Quinoid Dihydropteridine Reductase
7-03536	CHI Scientific	20µg	Ask for price

Recombinant Human Quinoid Dihydropteridine Reductase
7-03537	CHI Scientific	mg	Ask for price

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), APC
4-PAC758Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: QDPR (Met1~Phe244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with APC.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), Biotinylated
4-PAC758Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: QDPR (Met1~Phe244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with Biotin.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), Cy3
4-PAC758Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: QDPR (Met1~Phe244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with Cy3.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), FITC
4-PAC758Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: QDPR (Met1~Phe244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with FITC.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), HRP
4-PAC758Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: QDPR (Met1~Phe244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with HRP.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), PE
4-PAC758Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: QDPR (Met1~Phe244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with PE.

Mouse Qdpr/ Dihydropteridine reductase ELISA Kit
E1237Mo	Sunlong	1 Kit	EUR 632

Rat Dihydropteridine reductase, Qdpr ELISA KIT
ELI-08265r	Lifescience Market	96 Tests	EUR 886

Bovine Dihydropteridine reductase, QDPR ELISA KIT
ELI-46627b	Lifescience Market	96 Tests	EUR 928

Porcine Dihydropteridine reductase, QDPR ELISA KIT
ELI-48806p	Lifescience Market	96 Tests	EUR 928

Mouse Dihydropteridine reductase, Qdpr ELISA KIT
ELI-47113m	Lifescience Market	96 Tests	EUR 865

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7
4-PAC758Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: QDPR (Met1~Phe244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with APC-Cy7.

ELISA kit for Human Dihydropteridine reductase (QDPR)
KTE61007-48T	Abbkine	48T	EUR 332
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Human Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dihydropteridine reductase (QDPR)
KTE61007-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Human Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dihydropteridine reductase (QDPR)
KTE61007-96T	Abbkine	96T	EUR 539
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Human Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Dihydropteridine reductase (QDPR)
KTE100367-48T	Abbkine	48T	EUR 332
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Rat Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Dihydropteridine reductase (QDPR)
KTE100367-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Rat Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Dihydropteridine reductase (QDPR)
KTE100367-96T	Abbkine	96T	EUR 539
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Rat Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Dihydropteridine reductase (QDPR)
KTE10136-48T	Abbkine	48T	EUR 354
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Bovine Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Dihydropteridine reductase (QDPR)
KTE10136-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Bovine Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Dihydropteridine reductase (QDPR)
KTE10136-96T	Abbkine	96T	EUR 572
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Bovine Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Dihydropteridine reductase (QDPR)
KTE80061-48T	Abbkine	48T	EUR 354
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Pig Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Dihydropteridine reductase (QDPR)
KTE80061-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Pig Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Dihydropteridine reductase (QDPR)
KTE80061-96T	Abbkine	96T	EUR 572
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Pig Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dihydropteridine reductase (QDPR)
KTE70587-48T	Abbkine	48T	EUR 332
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dihydropteridine reductase (QDPR)
KTE70587-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dihydropteridine reductase (QDPR)
KTE70587-96T	Abbkine	96T	EUR 539
QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Qdpr ELISA Kit| Rat Dihydropteridine reductase ELISA Kit
EF019238	Lifescience Market	96 Tests	EUR 689

Qdpr ELISA Kit| Mouse Dihydropteridine reductase ELISA Kit
EF016017	Lifescience Market	96 Tests	EUR 689

QDPR ELISA Kit| Bovine Dihydropteridine reductase ELISA Kit
EF011829	Lifescience Market	96 Tests	EUR 689

Recombinant Human Dihydropteridine Reductase/QDPR (C-6His)
C852-10ug	Novoprotein	10ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0.

Recombinant Human Dihydropteridine Reductase/QDPR (C-6His)
C852-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0.

Recombinant Human Dihydropteridine Reductase/QDPR (C-6His)
C852-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0.

Recombinant Human Dihydropteridine Reductase/QDPR (C-6His)
C852-50ug	Novoprotein	50ug	EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0.

Human Dihydropteridine reductase ELISA kit
E01D0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropteridine reductase ELISA kit
E01D0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropteridine reductase ELISA kit
E01D0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dihydropteridine reductase ELISA kit
E02D0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dihydropteridine reductase ELISA kit
E02D0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dihydropteridine reductase ELISA kit
E02D0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dihydropteridine reductase ELISA kit
E03D0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dihydropteridine reductase ELISA kit
E03D0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dihydropteridine reductase ELISA kit
E03D0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dihydropteridine reductase ELISA kit
E06D0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dihydropteridine reductase ELISA kit
E06D0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dihydropteridine reductase ELISA kit
E06D0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dihydropteridine reductase ELISA kit
E04D0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dihydropteridine reductase ELISA kit
E04D0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dihydropteridine reductase ELISA kit
E04D0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dihydropteridine reductase ELISA kit
E09D0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dihydropteridine reductase ELISA kit
E09D0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dihydropteridine reductase ELISA kit
E09D0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dihydropteridine reductase ELISA kit
E08D0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dihydropteridine reductase ELISA kit
E08D0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dihydropteridine reductase ELISA kit
E08D0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dihydropteridine reductase ELISA kit
E07D0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dihydropteridine reductase ELISA kit
E07D0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dihydropteridine reductase ELISA kit
E07D0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Dihydropteridine reductase
EK3486	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dihydropteridine reductase in samples from serum, plasma, tissue homogenates and other biological fluids.

Guinea pig Dihydropteridine reductase ELISA kit
E05D0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dihydropteridine reductase ELISA kit
E05D0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dihydropteridine reductase ELISA kit
E05D0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant E.Coli Dihydropteridine Reductase
7-03217	CHI Scientific	5µg	Ask for price

Recombinant E.Coli Dihydropteridine Reductase
7-03218	CHI Scientific	20µg	Ask for price

Recombinant E.Coli Dihydropteridine Reductase
7-03219	CHI Scientific	1mg	Ask for price

E.Coli Dihydropteridine Reductase (Recombinant)
20-abx073300	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Human QDPR ELISA Kit
ELA-E14891h	Lifescience Market	96 Tests	EUR 824

QDPR ELISA KIT|Human
EF005813	Lifescience Market	96 Tests	EUR 689

QDPR, human recombinant
7821-100	Biovision		EUR 425

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

QDPR antibody
70R-19677	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal QDPR antibody

QDPR Antibody
33000-100ul	SAB	100ul	EUR 252

QDPR Antibody
43037-100ul	SAB	100ul	EUR 252

QDPR Antibody
1-CSB-PA019133GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against QDPR. Recognizes QDPR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

QDPR Antibody
1-CSB-PA019133LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against QDPR. Recognizes QDPR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

QDPR siRNA
20-abx904400	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

QDPR siRNA
20-abx930540	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

QDPR siRNA
20-abx930541	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-QDPR
YF-PA24533	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to QDPR

Human QDPR/DHPR Antibody
32872-05111	AssayPro	150 ug	EUR 261

Human QDPR shRNA Plasmid
20-abx953950	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

QDPR Recombinant Protein (Human)
RP025378	ABM	100 ug	Ask for price

Human GRHPR(Glyoxylate Reductase/Hydroxypyruvate Reductase) ELISA Kit
EH8934	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Glyoxylate Reductase/hydroxypyruvate Reductase (GRHPR) ELISA Kit
abx526194-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-2 months.

Human Methylenetetrahydrofolate Reductase ELISA kit
E01M0691-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Methylenetetrahydrofolate Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Methylenetetrahydrofolate Reductase ELISA kit
E01M0691-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Methylenetetrahydrofolate Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Methylenetetrahydrofolate Reductase ELISA kit
E01M0691-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Methylenetetrahydrofolate Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione Reductase ELISA kit
E01G0238-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione Reductase ELISA kit
E01G0238-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione Reductase ELISA kit
E01G0238-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose Reductase ELISA kit
E01A0773-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aldose Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose Reductase ELISA kit
E01A0773-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aldose Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose Reductase ELISA kit
E01A0773-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aldose Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione reductase ELISA kit
E01G0565-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione reductase ELISA kit
E01G0565-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione reductase ELISA kit
E01G0565-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

QDPR Conjugated Antibody
C43037	SAB	100ul	EUR 397

QDPR Conjugated Antibody
C33000	SAB	100ul	EUR 397

QDPR cloning plasmid
CSB-CL019133HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 735 Sequence: atggcggcggcggcggctgcaggcgaggcgcgccgggtgctggtgtacggcggcaggggcgctctgggttctcgatgcgtgcaggcttttcgggcccgcaactggtgggttgccagcgttgatgtggtggagaatgaagaggccagcgctagcatcattgttaaaatgacagactc Show more
Description: A cloning plasmid for the QDPR gene.

QDPR Rabbit pAb
A5733-100ul	Abclonal	100 ul	EUR 308

QDPR Rabbit pAb
A5733-200ul	Abclonal	200 ul	EUR 459

QDPR Rabbit pAb
A5733-20ul	Abclonal	20 ul	EUR 183

QDPR Rabbit pAb
A5733-50ul	Abclonal	50 ul	EUR 223

QDPR Polyclonal Antibody
A63254	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

QDPR Rabbit pAb
A3150-100ul	Abclonal	100 ul	EUR 308

QDPR Rabbit pAb
A3150-200ul	Abclonal	200 ul	EUR 459

QDPR Rabbit pAb
A3150-20ul	Abclonal	20 ul	Ask for price

QDPR Rabbit pAb
A3150-50ul	Abclonal	50 ul	Ask for price

anti- QDPR antibody
FNab06982	FN Test	100µg	EUR 505.25
Immunogen: quinoid dihydropteridine reductase Uniprot ID: P09417 Gene ID: 5860 Research Area: Metabolism
Description: Antibody raised against QDPR

Anti-QDPR antibody
PAab06982	Lifescience Market	100 ug	EUR 355

pSV40- Qdpr- m
PVT11601	Lifescience Market	2 ug	EUR 273

Anti-QDPR antibody
STJ111172	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase.

Anti-QDPR antibody
STJ28300	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase.

Anti-QDPR (M1)
YF-MA15076	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to QDPR

QDPR ORF Vector (Human) (pORF)
ORF008460	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human thioredoxin reductase,TrxR ELISA Kit
201-12-0931	SunredBio	96 tests	EUR 440
This thioredoxin reductase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sepiapterin Reductase (SPR) ELISA Kit
DLR-SPR-Hu-48T	DL Develop	48T	EUR 517
Should the Human Sepiapterin Reductase (SPR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sepiapterin Reductase (SPR) in samples from tissue homogenates or other biological fluids.

Human Sepiapterin Reductase (SPR) ELISA Kit
DLR-SPR-Hu-96T	DL Develop	96T	EUR 673
Should the Human Sepiapterin Reductase (SPR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sepiapterin Reductase (SPR) in samples from tissue homogenates or other biological fluids.

Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit
DLR-MTHFR-Hu-48T	DL Develop	48T	EUR 517
Should the Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Methylenetetrahydrofolate Reductase (MTHFR) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit
DLR-MTHFR-Hu-96T	DL Develop	96T	EUR 673
Should the Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Methylenetetrahydrofolate Reductase (MTHFR) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glutathione Reductase (GR) ELISA Kit
DLR-GR-Hu-48T	DL Develop	48T	EUR 498
Should the Human Glutathione Reductase (GR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione Reductase (GR) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Glutathione Reductase (GR) ELISA Kit
DLR-GR-Hu-96T	DL Develop	96T	EUR 647
Should the Human Glutathione Reductase (GR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione Reductase (GR) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Methylenetetrahydrofolate reductase(MTHFR) ELISA kit
CSB-EL015158HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Methylenetetrahydrofolate reductase (MTHFR) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Methylenetetrahydrofolate reductase(MTHFR) ELISA kit
1-CSB-EL015158HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Methylenetetrahydrofolate reductase(MTHFR) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human AKR1B1/ Aldose reductase ELISA Kit
E0102Hu	Sunlong	1 Kit	EUR 571

Human Aldose Reductase(AR) ELISA kit
E01A1369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose Reductase(AR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose Reductase(AR) ELISA kit
E01A1369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose Reductase(AR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose Reductase(AR) ELISA kit
E01A1369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose Reductase(AR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydrofolate reductase(DHFR) ELISA kit
E01D0284-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydrofolate reductase(DHFR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydrofolate reductase(DHFR) ELISA kit
E01D0284-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydrofolate reductase(DHFR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydrofolate reductase(DHFR) ELISA kit
E01D0284-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydrofolate reductase(DHFR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DHFR/ Dihydrofolate reductase ELISA Kit
E0688Hu	Sunlong	1 Kit	EUR 605

Human Thioredoxin reductase 1 ELISA kit
E01T0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin reductase 1 ELISA kit
E01T0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin reductase 1 ELISA kit
E01T0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin reductase 2 ELISA kit
E01T0363-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin reductase 2 ELISA kit
E01T0363-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin reductase 2 ELISA kit
E01T0363-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alkyl hydroperoxide reductase ELISA kit
E01A0692-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Alkyl hydroperoxide reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alkyl hydroperoxide reductase ELISA kit
E01A0692-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Alkyl hydroperoxide reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alkyl hydroperoxide reductase ELISA kit
E01A0692-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Alkyl hydroperoxide reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione Reductase (GSR) ELISA Kit
abx055465-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Glutathione Reductase (GR) ELISA Kit
20-abx151685	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit
20-abx152389	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sepiapterin Reductase (SPR) ELISA Kit
20-abx153057	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Aldose reductase (AKR1B1) ELISA Kit
abx251502-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Dihydrofolate Reductase (DHFR) ELISA Kit
abx251829-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Glutathione Reductase (GSR) ELISA Kit
abx252570-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

ELISA kit for Human Dihydrofolate reductase
EK4942	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dihydrofolate reductase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human MTHFR(Methylenetetrahydrofolate reductase) ELISA Kit
EH2340	FN Test	96T	EUR 567.6
Detection range: 31.25-2000 pg/ml Uniprot ID: P42898 Alias: MTHFR
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human DHFR(Dihydrofolate reductase) ELISA Kit
EH2463	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: P00374 Alias: DHFR/DHFR/DHFRP1/DYR/DHFRP1/dihydrofolate reductase/DYR/EC 1.5.1.3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human QDPR(Quinoid Dihydropteridine Reductase) ELISA Kit