Human QDPR(Quinoid Dihydropteridine Reductase) ELISA Kit

Human QDPR(Quinoid Dihydropteridine Reductase) ELISA Kit

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

RDR-QDPR-Hu-48Tests 48 Tests
EUR 544

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

RDR-QDPR-Hu-96Tests 96 Tests
EUR 756

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

RD-QDPR-Hu-48Tests 48 Tests
EUR 521

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

RD-QDPR-Hu-96Tests 96 Tests
EUR 723

Quinoid Dihydropteridine Reductase (QDPR) Antibody

20-abx004384
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody

20-abx127024
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody

20-abx128258
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody

abx122140-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody

20-abx141790
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody

20-abx174324
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Quinoid Dihydropteridine Reductase (QDPR) Antibody

abx034130-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody

abx034130-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody

abx236982-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody

20-abx318177
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Quinoid Dihydropteridine Reductase (QDPR)

4-RPC758Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P09417
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Quinoid Dihydropteridine Reductase expressed in: E.coli

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

20-abx152907
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

abx250962-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

abx571250-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

SEC758Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

SEC758Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

SEC758Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

SEC758Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids.

Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

4-SEC758Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Quinoid Dihydropteridine Reductase elisa. Alternative names of the recognized antigen: DHPR
  • PKU2
  • SDR33C1
  • HDHPR
  • 6, 7-Dihydropteridine Reductase
  • Short Chain Dehydrogenase/Reductase Family 33C, Member 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Quinoid Dihydropteridine Reductase (QDPR) Protein

20-abx166524
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cow Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

abx517175-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

abx517177-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Pig Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

abx517178-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit

abx517179-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Quinoid Dihydropteridine Reductase (QDPR) CLIA Kit

20-abx493885
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Quinoid Dihydropteridine Reductase (QDPR) Antibody (HRP)

20-abx305006
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody (FITC)

20-abx305007
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (QDPR) Antibody (Biotin)

20-abx305008
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human QDPR (Quinoid Dihydropteridine Reductase)

ELK3844 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Quinoid Dihydropteridine Reductase (QDPR). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of Quinoid Dihydropteridine Reductase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

QDPR Quinoid Dihydropteridine Reductase Human Recombinant Protein

PROTP09417 Regular: 20ug
EUR 317
Description: QDPR Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 267 amino acids (1-244 a.a.) and having a molecular mass of 28.2kDa.;QDPR is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig)

4-PAC758Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: QDPR (Met1~Phe244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR)

Quinoid Dihydropteridine Reductase Antibody

20-abx114950
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Quinoid Dihydropteridine Reductase (Recombinant)

20-abx073542
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human QDPR/ Dihydropteridine reductase ELISA Kit

E2111Hu 1 Kit
EUR 605

Human QDPR(Dihydropteridine reductase) ELISA Kit

EH1666 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P09417
  • Alias: QDPR/DHPR/HDHPR/PKU2/SDR33C1/DHPR member 1/Dihydropteridine reductase/Quinoid Dihydropteridine Reductase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Dihydropteridine reductase, QDPR ELISA KIT

ELI-26300h 96 Tests
EUR 824

Recombinant Human Quinoid Dihydropteridine Reductase

7-03535 5µg Ask for price

Recombinant Human Quinoid Dihydropteridine Reductase

7-03536 20µg Ask for price

Recombinant Human Quinoid Dihydropteridine Reductase

7-03537 mg Ask for price

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), APC

4-PAC758Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: QDPR (Met1~Phe244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with APC.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), Biotinylated

4-PAC758Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: QDPR (Met1~Phe244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with Biotin.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), Cy3

4-PAC758Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: QDPR (Met1~Phe244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with Cy3.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), FITC

4-PAC758Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: QDPR (Met1~Phe244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with FITC.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), HRP

4-PAC758Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: QDPR (Met1~Phe244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with HRP.

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), PE

4-PAC758Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: QDPR (Met1~Phe244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with PE.

Mouse Qdpr/ Dihydropteridine reductase ELISA Kit

E1237Mo 1 Kit
EUR 632

Rat Dihydropteridine reductase, Qdpr ELISA KIT

ELI-08265r 96 Tests
EUR 886

Bovine Dihydropteridine reductase, QDPR ELISA KIT

ELI-46627b 96 Tests
EUR 928

Porcine Dihydropteridine reductase, QDPR ELISA KIT

ELI-48806p 96 Tests
EUR 928

Mouse Dihydropteridine reductase, Qdpr ELISA KIT

ELI-47113m 96 Tests
EUR 865

Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7

4-PAC758Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: QDPR (Met1~Phe244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with APC-Cy7.

ELISA kit for Human Dihydropteridine reductase (QDPR)

KTE61007-48T 48T
EUR 332
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dihydropteridine reductase (QDPR)

KTE61007-5platesof96wells 5 plates of 96 wells
EUR 2115
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dihydropteridine reductase (QDPR)

KTE61007-96T 96T
EUR 539
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Dihydropteridine reductase (QDPR)

KTE100367-48T 48T
EUR 332
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Dihydropteridine reductase (QDPR)

KTE100367-5platesof96wells 5 plates of 96 wells
EUR 2115
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Dihydropteridine reductase (QDPR)

KTE100367-96T 96T
EUR 539
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Dihydropteridine reductase (QDPR)

KTE10136-48T 48T
EUR 354
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Dihydropteridine reductase (QDPR)

KTE10136-5platesof96wells 5 plates of 96 wells
EUR 2252
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Dihydropteridine reductase (QDPR)

KTE10136-96T 96T
EUR 572
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Dihydropteridine reductase (QDPR)

KTE80061-48T 48T
EUR 354
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Dihydropteridine reductase (QDPR)

KTE80061-5platesof96wells 5 plates of 96 wells
EUR 2252
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Dihydropteridine reductase (QDPR)

KTE80061-96T 96T
EUR 572
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dihydropteridine reductase (QDPR)

KTE70587-48T 48T
EUR 332
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dihydropteridine reductase (QDPR)

KTE70587-5platesof96wells 5 plates of 96 wells
EUR 2115
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Dihydropteridine reductase (QDPR)

KTE70587-96T 96T
EUR 539
  • QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Qdpr ELISA Kit| Rat Dihydropteridine reductase ELISA Kit

EF019238 96 Tests
EUR 689

Qdpr ELISA Kit| Mouse Dihydropteridine reductase ELISA Kit

EF016017 96 Tests
EUR 689

QDPR ELISA Kit| Bovine Dihydropteridine reductase ELISA Kit

EF011829 96 Tests
EUR 689

Recombinant Human Dihydropteridine Reductase/QDPR (C-6His)

C852-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0.

Recombinant Human Dihydropteridine Reductase/QDPR (C-6His)

C852-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0.

Recombinant Human Dihydropteridine Reductase/QDPR (C-6His)

C852-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0.

Recombinant Human Dihydropteridine Reductase/QDPR (C-6His)

C852-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0.

Human Dihydropteridine reductase ELISA kit

E01D0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropteridine reductase ELISA kit

E01D0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropteridine reductase ELISA kit

E01D0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dihydropteridine reductase ELISA kit

E02D0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dihydropteridine reductase ELISA kit

E02D0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dihydropteridine reductase ELISA kit

E02D0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dihydropteridine reductase ELISA kit

E03D0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dihydropteridine reductase ELISA kit

E03D0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dihydropteridine reductase ELISA kit

E03D0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dihydropteridine reductase ELISA kit

E06D0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dihydropteridine reductase ELISA kit

E06D0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dihydropteridine reductase ELISA kit

E06D0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dihydropteridine reductase ELISA kit

E04D0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dihydropteridine reductase ELISA kit

E04D0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dihydropteridine reductase ELISA kit

E04D0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dihydropteridine reductase ELISA kit

E09D0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dihydropteridine reductase ELISA kit

E09D0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dihydropteridine reductase ELISA kit

E09D0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dihydropteridine reductase ELISA kit

E08D0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dihydropteridine reductase ELISA kit

E08D0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dihydropteridine reductase ELISA kit

E08D0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dihydropteridine reductase ELISA kit

E07D0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dihydropteridine reductase ELISA kit

E07D0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dihydropteridine reductase ELISA kit

E07D0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Dihydropteridine reductase

EK3486 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dihydropteridine reductase in samples from serum, plasma, tissue homogenates and other biological fluids.

Guinea pig Dihydropteridine reductase ELISA kit

E05D0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dihydropteridine reductase ELISA kit

E05D0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dihydropteridine reductase ELISA kit

E05D0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant E.Coli Dihydropteridine Reductase

7-03217 5µg Ask for price

Recombinant E.Coli Dihydropteridine Reductase

7-03218 20µg Ask for price

Recombinant E.Coli Dihydropteridine Reductase

7-03219 1mg Ask for price

E.Coli Dihydropteridine Reductase (Recombinant)

20-abx073300
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human QDPR ELISA Kit

ELA-E14891h 96 Tests
EUR 824

QDPR ELISA KIT|Human

EF005813 96 Tests
EUR 689

QDPR, human recombinant

7821-100
EUR 425

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

QDPR antibody

70R-19677 50 ul
EUR 435
Description: Rabbit polyclonal QDPR antibody

QDPR Antibody

33000-100ul 100ul
EUR 252

QDPR Antibody

43037-100ul 100ul
EUR 252

QDPR Antibody

1-CSB-PA019133GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against QDPR. Recognizes QDPR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

QDPR Antibody

1-CSB-PA019133LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against QDPR. Recognizes QDPR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

QDPR siRNA

20-abx904400
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

QDPR siRNA

20-abx930540
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

QDPR siRNA

20-abx930541
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-QDPR

YF-PA24533 50 ul
EUR 334
Description: Mouse polyclonal to QDPR

Human QDPR/DHPR Antibody

32872-05111 150 ug
EUR 261

Human QDPR shRNA Plasmid

20-abx953950
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

QDPR Recombinant Protein (Human)

RP025378 100 ug Ask for price

Human GRHPR(Glyoxylate Reductase/Hydroxypyruvate Reductase) ELISA Kit

EH8934 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Glyoxylate Reductase/hydroxypyruvate Reductase (GRHPR) ELISA Kit

abx526194-96tests 96 tests
EUR 668
  • Shipped within 1-2 months.

Human Methylenetetrahydrofolate Reductase ELISA kit

E01M0691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Methylenetetrahydrofolate Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Methylenetetrahydrofolate Reductase ELISA kit

E01M0691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Methylenetetrahydrofolate Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Methylenetetrahydrofolate Reductase ELISA kit

E01M0691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Methylenetetrahydrofolate Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione Reductase ELISA kit

E01G0238-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione Reductase ELISA kit

E01G0238-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione Reductase ELISA kit

E01G0238-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose Reductase ELISA kit

E01A0773-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aldose Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose Reductase ELISA kit

E01A0773-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aldose Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose Reductase ELISA kit

E01A0773-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aldose Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione reductase ELISA kit

E01G0565-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione reductase ELISA kit

E01G0565-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione reductase ELISA kit

E01G0565-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

QDPR Conjugated Antibody

C43037 100ul
EUR 397

QDPR Conjugated Antibody

C33000 100ul
EUR 397

QDPR cloning plasmid

CSB-CL019133HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: atggcggcggcggcggctgcaggcgaggcgcgccgggtgctggtgtacggcggcaggggcgctctgggttctcgatgcgtgcaggcttttcgggcccgcaactggtgggttgccagcgttgatgtggtggagaatgaagaggccagcgctagcatcattgttaaaatgacagactc
  • Show more
Description: A cloning plasmid for the QDPR gene.

QDPR Rabbit pAb

A5733-100ul 100 ul
EUR 308

QDPR Rabbit pAb

A5733-200ul 200 ul
EUR 459

QDPR Rabbit pAb

A5733-20ul 20 ul
EUR 183

QDPR Rabbit pAb

A5733-50ul 50 ul
EUR 223

QDPR Polyclonal Antibody

A63254 100 µg
EUR 570.55
Description: fast delivery possible

QDPR Rabbit pAb

A3150-100ul 100 ul
EUR 308

QDPR Rabbit pAb

A3150-200ul 200 ul
EUR 459

QDPR Rabbit pAb

A3150-20ul 20 ul Ask for price

QDPR Rabbit pAb

A3150-50ul 50 ul Ask for price

anti- QDPR antibody

FNab06982 100µg
EUR 505.25
  • Immunogen: quinoid dihydropteridine reductase
  • Uniprot ID: P09417
  • Gene ID: 5860
  • Research Area: Metabolism
Description: Antibody raised against QDPR

Anti-QDPR antibody

PAab06982 100 ug
EUR 355

pSV40- Qdpr- m

PVT11601 2 ug
EUR 273

Anti-QDPR antibody

STJ111172 100 µl
EUR 277
Description: This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase.

Anti-QDPR antibody

STJ28300 100 µl
EUR 277
Description: This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase.

Anti-QDPR (M1)

YF-MA15076 100 ug
EUR 363
Description: Mouse monoclonal to QDPR

QDPR ORF Vector (Human) (pORF)

ORF008460 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human thioredoxin reductase,TrxR ELISA Kit

201-12-0931 96 tests
EUR 440
  • This thioredoxin reductase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sepiapterin Reductase (SPR) ELISA Kit

DLR-SPR-Hu-48T 48T
EUR 517
  • Should the Human Sepiapterin Reductase (SPR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sepiapterin Reductase (SPR) in samples from tissue homogenates or other biological fluids.

Human Sepiapterin Reductase (SPR) ELISA Kit

DLR-SPR-Hu-96T 96T
EUR 673
  • Should the Human Sepiapterin Reductase (SPR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sepiapterin Reductase (SPR) in samples from tissue homogenates or other biological fluids.

Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit

DLR-MTHFR-Hu-48T 48T
EUR 517
  • Should the Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Methylenetetrahydrofolate Reductase (MTHFR) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit

DLR-MTHFR-Hu-96T 96T
EUR 673
  • Should the Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Methylenetetrahydrofolate Reductase (MTHFR) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glutathione Reductase (GR) ELISA Kit

DLR-GR-Hu-48T 48T
EUR 498
  • Should the Human Glutathione Reductase (GR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione Reductase (GR) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Glutathione Reductase (GR) ELISA Kit

DLR-GR-Hu-96T 96T
EUR 647
  • Should the Human Glutathione Reductase (GR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione Reductase (GR) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Methylenetetrahydrofolate reductase(MTHFR) ELISA kit

CSB-EL015158HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Methylenetetrahydrofolate reductase (MTHFR) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Methylenetetrahydrofolate reductase(MTHFR) ELISA kit

1-CSB-EL015158HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Methylenetetrahydrofolate reductase(MTHFR) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human AKR1B1/ Aldose reductase ELISA Kit

E0102Hu 1 Kit
EUR 571

Human Aldose Reductase(AR) ELISA kit

E01A1369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose Reductase(AR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose Reductase(AR) ELISA kit

E01A1369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose Reductase(AR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldose Reductase(AR) ELISA kit

E01A1369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aldose Reductase(AR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydrofolate reductase(DHFR) ELISA kit

E01D0284-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydrofolate reductase(DHFR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydrofolate reductase(DHFR) ELISA kit

E01D0284-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydrofolate reductase(DHFR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydrofolate reductase(DHFR) ELISA kit

E01D0284-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydrofolate reductase(DHFR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DHFR/ Dihydrofolate reductase ELISA Kit

E0688Hu 1 Kit
EUR 605

Human Thioredoxin reductase 1 ELISA kit

E01T0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin reductase 1 ELISA kit

E01T0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin reductase 1 ELISA kit

E01T0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin reductase 2 ELISA kit

E01T0363-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin reductase 2 ELISA kit

E01T0363-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thioredoxin reductase 2 ELISA kit

E01T0363-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alkyl hydroperoxide reductase ELISA kit

E01A0692-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alkyl hydroperoxide reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alkyl hydroperoxide reductase ELISA kit

E01A0692-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alkyl hydroperoxide reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alkyl hydroperoxide reductase ELISA kit

E01A0692-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alkyl hydroperoxide reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione Reductase (GSR) ELISA Kit

abx055465-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Glutathione Reductase (GR) ELISA Kit

20-abx151685
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit

20-abx152389
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sepiapterin Reductase (SPR) ELISA Kit

20-abx153057
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aldose reductase (AKR1B1) ELISA Kit

abx251502-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Dihydrofolate Reductase (DHFR) ELISA Kit

abx251829-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Glutathione Reductase (GSR) ELISA Kit

abx252570-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

ELISA kit for Human Dihydrofolate reductase

EK4942 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dihydrofolate reductase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human MTHFR(Methylenetetrahydrofolate reductase) ELISA Kit

EH2340 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P42898
  • Alias: MTHFR
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human DHFR(Dihydrofolate reductase) ELISA Kit

EH2463 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: P00374
  • Alias: DHFR/DHFR/DHFRP1/DYR/DHFRP1/dihydrofolate reductase/DYR/EC 1.5.1.3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human QDPR(Quinoid Dihydropteridine Reductase) ELISA Kit