Human QDPR(Quinoid Dihydropteridine Reductase) ELISA Kit
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
RDR-QDPR-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
RDR-QDPR-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
RD-QDPR-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
RD-QDPR-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Quinoid Dihydropteridine Reductase (QDPR) Antibody |
20-abx004384 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody |
20-abx127024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody |
20-abx128258 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody |
abx122140-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody |
20-abx141790 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody |
20-abx174324 |
Abbexa |
|
|
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody |
abx034130-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody |
abx034130-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody |
abx236982-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody |
20-abx318177 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Quinoid Dihydropteridine Reductase (QDPR) |
4-RPC758Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P09417
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.5kDa
- Isoelectric Point: 6.9
|
Description: Recombinant Human Quinoid Dihydropteridine Reductase expressed in: E.coli |
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
20-abx152907 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
abx250962-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
abx571250-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
SEC758Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids. |
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
SEC758Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids. |
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
SEC758Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids. |
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
SEC758Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Quinoid Dihydropteridine Reductase (QDPR) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in Tissue homogenates, cell lysates and other biological fluids. |
Human Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
4-SEC758Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Quinoid Dihydropteridine Reductase elisa. Alternative names of the recognized antigen: DHPR
- PKU2
- SDR33C1
- HDHPR
- 6, 7-Dihydropteridine Reductase
- Short Chain Dehydrogenase/Reductase Family 33C, Member 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Quinoid Dihydropteridine Reductase (QDPR) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Quinoid Dihydropteridine Reductase (QDPR) Protein |
20-abx166524 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cow Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
abx517175-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
abx517177-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Pig Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
abx517178-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Quinoid Dihydropteridine Reductase (QDPR) ELISA Kit |
abx517179-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Quinoid Dihydropteridine Reductase (QDPR) CLIA Kit |
20-abx493885 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody (HRP) |
20-abx305006 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody (FITC) |
20-abx305007 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Quinoid Dihydropteridine Reductase (QDPR) Antibody (Biotin) |
20-abx305008 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Human QDPR (Quinoid Dihydropteridine Reductase) |
ELK3844 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Quinoid Dihydropteridine Reductase (QDPR). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
- Show more
|
Description: A sandwich ELISA kit for detection of Quinoid Dihydropteridine Reductase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
QDPR Quinoid Dihydropteridine Reductase Human Recombinant Protein |
PROTP09417 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: QDPR Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 267 amino acids (1-244 a.a.) and having a molecular mass of 28.2kDa.;QDPR is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig) |
4-PAC758Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: QDPR (Met1~Phe244)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR) |
Quinoid Dihydropteridine Reductase Antibody |
20-abx114950 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Quinoid Dihydropteridine Reductase (Recombinant) |
20-abx073542 |
Abbexa |
-
EUR 4490.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human QDPR/ Dihydropteridine reductase ELISA Kit |
E2111Hu |
Sunlong |
1 Kit |
EUR 605 |
Human QDPR(Dihydropteridine reductase) ELISA Kit |
EH1666 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: P09417
- Alias: QDPR/DHPR/HDHPR/PKU2/SDR33C1/DHPR member 1/Dihydropteridine reductase/Quinoid Dihydropteridine Reductase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Dihydropteridine reductase, QDPR ELISA KIT |
ELI-26300h |
Lifescience Market |
96 Tests |
EUR 824 |
Recombinant Human Quinoid Dihydropteridine Reductase |
7-03535 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Quinoid Dihydropteridine Reductase |
7-03536 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human Quinoid Dihydropteridine Reductase |
7-03537 |
CHI Scientific |
mg |
Ask for price |
Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), APC |
4-PAC758Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: QDPR (Met1~Phe244)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with APC. |
Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), Biotinylated |
4-PAC758Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: QDPR (Met1~Phe244)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with Biotin. |
Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), Cy3 |
4-PAC758Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: QDPR (Met1~Phe244)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with Cy3. |
Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), FITC |
4-PAC758Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: QDPR (Met1~Phe244)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with FITC. |
Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), HRP |
4-PAC758Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: QDPR (Met1~Phe244)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with HRP. |
Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), PE |
4-PAC758Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: QDPR (Met1~Phe244)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with PE. |
Mouse Qdpr/ Dihydropteridine reductase ELISA Kit |
E1237Mo |
Sunlong |
1 Kit |
EUR 632 |
Rat Dihydropteridine reductase, Qdpr ELISA KIT |
ELI-08265r |
Lifescience Market |
96 Tests |
EUR 886 |
Bovine Dihydropteridine reductase, QDPR ELISA KIT |
ELI-46627b |
Lifescience Market |
96 Tests |
EUR 928 |
Porcine Dihydropteridine reductase, QDPR ELISA KIT |
ELI-48806p |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Dihydropteridine reductase, Qdpr ELISA KIT |
ELI-47113m |
Lifescience Market |
96 Tests |
EUR 865 |
Quinoid Dihydropteridine Reductase (QDPR) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7 |
4-PAC758Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: QDPR (Met1~Phe244)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Quinoid Dihydropteridine Reductase (QDPR). This antibody is labeled with APC-Cy7. |
ELISA kit for Human Dihydropteridine reductase (QDPR) |
KTE61007-48T |
Abbkine |
48T |
EUR 332 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Dihydropteridine reductase (QDPR) |
KTE61007-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Dihydropteridine reductase (QDPR) |
KTE61007-96T |
Abbkine |
96T |
EUR 539 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Dihydropteridine reductase (QDPR) |
KTE100367-48T |
Abbkine |
48T |
EUR 332 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Dihydropteridine reductase (QDPR) |
KTE100367-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Dihydropteridine reductase (QDPR) |
KTE100367-96T |
Abbkine |
96T |
EUR 539 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Dihydropteridine reductase (QDPR) |
KTE10136-48T |
Abbkine |
48T |
EUR 354 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Dihydropteridine reductase (QDPR) |
KTE10136-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Dihydropteridine reductase (QDPR) |
KTE10136-96T |
Abbkine |
96T |
EUR 572 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Dihydropteridine reductase (QDPR) |
KTE80061-48T |
Abbkine |
48T |
EUR 354 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Dihydropteridine reductase (QDPR) |
KTE80061-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Dihydropteridine reductase (QDPR) |
KTE80061-96T |
Abbkine |
96T |
EUR 572 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Dihydropteridine reductase (QDPR) |
KTE70587-48T |
Abbkine |
48T |
EUR 332 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Dihydropteridine reductase (QDPR) |
KTE70587-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Dihydropteridine reductase (QDPR) |
KTE70587-96T |
Abbkine |
96T |
EUR 539 |
- QDPR (quinoid dihydropteridine reductase) is part of the pathway that recycles a substance called tetrahydrobiopterin, also known as BH4. Tetrahydrobiopterin works with an enzyme called phenylalanine hydroxylase to process a substance called phenylal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Dihydropteridine reductase (QDPR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Qdpr ELISA Kit| Rat Dihydropteridine reductase ELISA Kit |
EF019238 |
Lifescience Market |
96 Tests |
EUR 689 |
Qdpr ELISA Kit| Mouse Dihydropteridine reductase ELISA Kit |
EF016017 |
Lifescience Market |
96 Tests |
EUR 689 |
QDPR ELISA Kit| Bovine Dihydropteridine reductase ELISA Kit |
EF011829 |
Lifescience Market |
96 Tests |
EUR 689 |
Recombinant Human Dihydropteridine Reductase/QDPR (C-6His) |
C852-10ug |
Novoprotein |
10ug |
EUR 156 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0. |
Recombinant Human Dihydropteridine Reductase/QDPR (C-6His) |
C852-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0. |
Recombinant Human Dihydropteridine Reductase/QDPR (C-6His) |
C852-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0. |
Recombinant Human Dihydropteridine Reductase/QDPR (C-6His) |
C852-50ug |
Novoprotein |
50ug |
EUR 369 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl,pH8.0. |
Human Dihydropteridine reductase ELISA kit |
E01D0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydropteridine reductase ELISA kit |
E01D0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydropteridine reductase ELISA kit |
E01D0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Dihydropteridine reductase ELISA kit |
E02D0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Dihydropteridine reductase ELISA kit |
E02D0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Dihydropteridine reductase ELISA kit |
E02D0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dihydropteridine reductase ELISA kit |
E03D0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dihydropteridine reductase ELISA kit |
E03D0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dihydropteridine reductase ELISA kit |
E03D0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Dihydropteridine reductase ELISA kit |
E06D0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Dihydropteridine reductase ELISA kit |
E06D0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Dihydropteridine reductase ELISA kit |
E06D0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Dihydropteridine reductase ELISA kit |
E04D0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Dihydropteridine reductase ELISA kit |
E04D0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Dihydropteridine reductase ELISA kit |
E04D0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Dihydropteridine reductase ELISA kit |
E09D0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Dihydropteridine reductase ELISA kit |
E09D0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Dihydropteridine reductase ELISA kit |
E09D0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Dihydropteridine reductase ELISA kit |
E08D0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Dihydropteridine reductase ELISA kit |
E08D0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Dihydropteridine reductase ELISA kit |
E08D0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Dihydropteridine reductase ELISA kit |
E07D0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Dihydropteridine reductase ELISA kit |
E07D0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Dihydropteridine reductase ELISA kit |
E07D0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Dihydropteridine reductase |
EK3486 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dihydropteridine reductase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Guinea pig Dihydropteridine reductase ELISA kit |
E05D0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Dihydropteridine reductase ELISA kit |
E05D0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Dihydropteridine reductase ELISA kit |
E05D0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Dihydropteridine reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Recombinant E.Coli Dihydropteridine Reductase |
7-03217 |
CHI Scientific |
5µg |
Ask for price |
Recombinant E.Coli Dihydropteridine Reductase |
7-03218 |
CHI Scientific |
20µg |
Ask for price |
Recombinant E.Coli Dihydropteridine Reductase |
7-03219 |
CHI Scientific |
1mg |
Ask for price |
E.Coli Dihydropteridine Reductase (Recombinant) |
20-abx073300 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
QDPR, human recombinant |
7821-100 |
Biovision |
|
EUR 425 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
QDPR antibody |
70R-19677 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal QDPR antibody |
QDPR Antibody |
33000-100ul |
SAB |
100ul |
EUR 252 |
QDPR Antibody |
43037-100ul |
SAB |
100ul |
EUR 252 |
QDPR Antibody |
1-CSB-PA019133GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against QDPR. Recognizes QDPR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
QDPR Antibody |
1-CSB-PA019133LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against QDPR. Recognizes QDPR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
QDPR siRNA |
20-abx904400 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
QDPR siRNA |
20-abx930540 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
QDPR siRNA |
20-abx930541 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-QDPR |
YF-PA24533 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to QDPR |
Human QDPR/DHPR Antibody |
32872-05111 |
AssayPro |
150 ug |
EUR 261 |
Human QDPR shRNA Plasmid |
20-abx953950 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
QDPR Recombinant Protein (Human) |
RP025378 |
ABM |
100 ug |
Ask for price |
Human GRHPR(Glyoxylate Reductase/Hydroxypyruvate Reductase) ELISA Kit |
EH8934 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Glyoxylate Reductase/hydroxypyruvate Reductase (GRHPR) ELISA Kit |
abx526194-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-2 months.
|
Human Methylenetetrahydrofolate Reductase ELISA kit |
E01M0691-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Methylenetetrahydrofolate Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Methylenetetrahydrofolate Reductase ELISA kit |
E01M0691-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Methylenetetrahydrofolate Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Methylenetetrahydrofolate Reductase ELISA kit |
E01M0691-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Methylenetetrahydrofolate Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutathione Reductase ELISA kit |
E01G0238-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutathione Reductase ELISA kit |
E01G0238-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutathione Reductase ELISA kit |
E01G0238-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aldose Reductase ELISA kit |
E01A0773-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Aldose Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aldose Reductase ELISA kit |
E01A0773-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Aldose Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aldose Reductase ELISA kit |
E01A0773-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Aldose Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutathione reductase ELISA kit |
E01G0565-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutathione reductase ELISA kit |
E01G0565-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutathione reductase ELISA kit |
E01G0565-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
QDPR Conjugated Antibody |
C43037 |
SAB |
100ul |
EUR 397 |
QDPR Conjugated Antibody |
C33000 |
SAB |
100ul |
EUR 397 |
QDPR cloning plasmid |
CSB-CL019133HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 735
- Sequence: atggcggcggcggcggctgcaggcgaggcgcgccgggtgctggtgtacggcggcaggggcgctctgggttctcgatgcgtgcaggcttttcgggcccgcaactggtgggttgccagcgttgatgtggtggagaatgaagaggccagcgctagcatcattgttaaaatgacagactc
- Show more
|
Description: A cloning plasmid for the QDPR gene. |
QDPR Rabbit pAb |
A5733-100ul |
Abclonal |
100 ul |
EUR 308 |
QDPR Rabbit pAb |
A5733-200ul |
Abclonal |
200 ul |
EUR 459 |
QDPR Rabbit pAb |
A5733-20ul |
Abclonal |
20 ul |
EUR 183 |
QDPR Rabbit pAb |
A5733-50ul |
Abclonal |
50 ul |
EUR 223 |
QDPR Polyclonal Antibody |
A63254 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
QDPR Rabbit pAb |
A3150-100ul |
Abclonal |
100 ul |
EUR 308 |
QDPR Rabbit pAb |
A3150-200ul |
Abclonal |
200 ul |
EUR 459 |
QDPR Rabbit pAb |
A3150-20ul |
Abclonal |
20 ul |
Ask for price |
QDPR Rabbit pAb |
A3150-50ul |
Abclonal |
50 ul |
Ask for price |
anti- QDPR antibody |
FNab06982 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: quinoid dihydropteridine reductase
- Uniprot ID: P09417
- Gene ID: 5860
- Research Area: Metabolism
|
Description: Antibody raised against QDPR |
Anti-QDPR antibody |
STJ111172 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. |
Anti-QDPR antibody |
STJ28300 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. |
Anti-QDPR (M1) |
YF-MA15076 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to QDPR |
QDPR ORF Vector (Human) (pORF) |
ORF008460 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Human thioredoxin reductase,TrxR ELISA Kit |
201-12-0931 |
SunredBio |
96 tests |
EUR 440 |
- This thioredoxin reductase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Sepiapterin Reductase (SPR) ELISA Kit |
DLR-SPR-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Sepiapterin Reductase (SPR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Sepiapterin Reductase (SPR) in samples from tissue homogenates or other biological fluids. |
Human Sepiapterin Reductase (SPR) ELISA Kit |
DLR-SPR-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Sepiapterin Reductase (SPR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Sepiapterin Reductase (SPR) in samples from tissue homogenates or other biological fluids. |
Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit |
DLR-MTHFR-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Methylenetetrahydrofolate Reductase (MTHFR) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit |
DLR-MTHFR-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Methylenetetrahydrofolate Reductase (MTHFR) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Glutathione Reductase (GR) ELISA Kit |
DLR-GR-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Glutathione Reductase (GR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione Reductase (GR) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Glutathione Reductase (GR) ELISA Kit |
DLR-GR-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Glutathione Reductase (GR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione Reductase (GR) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Methylenetetrahydrofolate reductase(MTHFR) ELISA kit |
CSB-EL015158HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Methylenetetrahydrofolate reductase (MTHFR) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Methylenetetrahydrofolate reductase(MTHFR) ELISA kit |
1-CSB-EL015158HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Methylenetetrahydrofolate reductase(MTHFR) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human AKR1B1/ Aldose reductase ELISA Kit |
E0102Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Aldose Reductase(AR) ELISA kit |
E01A1369-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Aldose Reductase(AR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aldose Reductase(AR) ELISA kit |
E01A1369-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Aldose Reductase(AR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aldose Reductase(AR) ELISA kit |
E01A1369-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Aldose Reductase(AR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydrofolate reductase(DHFR) ELISA kit |
E01D0284-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dihydrofolate reductase(DHFR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydrofolate reductase(DHFR) ELISA kit |
E01D0284-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dihydrofolate reductase(DHFR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dihydrofolate reductase(DHFR) ELISA kit |
E01D0284-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dihydrofolate reductase(DHFR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DHFR/ Dihydrofolate reductase ELISA Kit |
E0688Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Thioredoxin reductase 1 ELISA kit |
E01T0354-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thioredoxin reductase 1 ELISA kit |
E01T0354-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thioredoxin reductase 1 ELISA kit |
E01T0354-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thioredoxin reductase 2 ELISA kit |
E01T0363-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thioredoxin reductase 2 ELISA kit |
E01T0363-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thioredoxin reductase 2 ELISA kit |
E01T0363-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thioredoxin reductase 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Alkyl hydroperoxide reductase ELISA kit |
E01A0692-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Alkyl hydroperoxide reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Alkyl hydroperoxide reductase ELISA kit |
E01A0692-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Alkyl hydroperoxide reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Alkyl hydroperoxide reductase ELISA kit |
E01A0692-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Alkyl hydroperoxide reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutathione Reductase (GSR) ELISA Kit |
abx055465-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Glutathione Reductase (GR) ELISA Kit |
20-abx151685 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Methylenetetrahydrofolate Reductase (MTHFR) ELISA Kit |
20-abx152389 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Sepiapterin Reductase (SPR) ELISA Kit |
20-abx153057 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Aldose reductase (AKR1B1) ELISA Kit |
abx251502-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Dihydrofolate Reductase (DHFR) ELISA Kit |
abx251829-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Glutathione Reductase (GSR) ELISA Kit |
abx252570-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Dihydrofolate reductase |
EK4942 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dihydrofolate reductase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human MTHFR(Methylenetetrahydrofolate reductase) ELISA Kit |
EH2340 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: P42898
- Alias: MTHFR
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human DHFR(Dihydrofolate reductase) ELISA Kit |
EH2463 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78.125-5000 pg/ml
- Uniprot ID: P00374
- Alias: DHFR/DHFR/DHFRP1/DYR/DHFRP1/dihydrofolate reductase/DYR/EC 1.5.1.3
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml |
Human QDPR(Quinoid Dihydropteridine Reductase) ELISA Kit