Human PPL(Periplakin) ELISA Kit

Human PPL(Periplakin) ELISA Kit

Human Periplakin (PPL) ELISA Kit
RD-PPL-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Periplakin (PPL) ELISA Kit
RD-PPL-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Periplakin (PPL) ELISA Kit
RDR-PPL-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Periplakin (PPL) ELISA Kit
RDR-PPL-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Periplakin (PPL) ELISA Kit
DLR-PPL-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Periplakin (PPL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Periplakin (PPL) ELISA Kit
DLR-PPL-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Periplakin (PPL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Periplakin (PPL) ELISA Kit
RD-PPL-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Periplakin (PPL) ELISA Kit
RD-PPL-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Periplakin (PPL) ELISA Kit
RDR-PPL-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Periplakin (PPL) ELISA Kit
RDR-PPL-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Periplakin, PPL ELISA KIT
ELI-15152h	Lifescience Market	96 Tests	EUR 824

Human Periplakin (PPL) ELISA Kit
20-abx152709	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Periplakin(PPL)ELISA Kit
QY-E02006	Qayee Biotechnology	96T	EUR 361

Human Periplakin (PPL) ELISA Kit
SEH334Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Periplakin (PPL) ELISA Kit
SEH334Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Periplakin (PPL) ELISA Kit
SEH334Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Periplakin (PPL) ELISA Kit
SEH334Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Periplakin (PPL) ELISA Kit
4-SEH334Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Periplakin elisa. Alternative names of the recognized antigen: 190 kDa paraneoplastic pemphigus antigen 195 kDa cornified envelope precursor protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Periplakin, Ppl ELISA KIT
ELI-35659m	Lifescience Market	96 Tests	EUR 865

Mouse Periplakin (PPL) ELISA Kit
20-abx154532	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Periplakin(PPL)ELISA Kit
QY-E21728	Qayee Biotechnology	96T	EUR 374

Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Periplakin (PPL) ELISA Kit
4-SEH334Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Periplakin elisa. Alternative names of the recognized antigen: 190 kDa paraneoplastic pemphigus antigen 195 kDa cornified envelope precursor protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Periplakin (PPL) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Periplakin (PPL) Antibody
20-abx129708	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Periplakin (PPL) Antibody
abx038117-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Periplakin (PPL) Antibody
20-abx100391	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Periplakin (PPL) Antibody
20-abx100392	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Periplakin (PPL) Antibody
20-abx005273	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Periplakin (PPL) Antibody
20-abx177959	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Recombinant Periplakin (PPL)
4-RPH334Hu01	Cloud-Clone	EUR 528.29 EUR 244.00 EUR 1706.08 EUR 635.36 EUR 1170.72 EUR 416.00 EUR 4115.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O60437 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Periplakin expressed in: E.coli

Recombinant Periplakin (PPL)
4-RPH334Hu02	Cloud-Clone	EUR 528.29 EUR 244.00 EUR 1706.08 EUR 635.36 EUR 1170.72 EUR 416.00 EUR 4115.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O60437 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 64.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Periplakin expressed in: E.coli

Recombinant Periplakin (PPL)
4-RPH334Mu01	Cloud-Clone	EUR 492.45 EUR 235.00 EUR 1571.68 EUR 590.56 EUR 1081.12 EUR 392.00 EUR 3779.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9R269 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.1kDa Isoelectric Point: 6
Description: Recombinant Mouse Periplakin expressed in: E.coli

ELISA kit for Human PPL (Periplakin)
ELK3840	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Periplakin (PPL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Periplakin (PPL). Show more
Description: A sandwich ELISA kit for detection of Periplakin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Periplakin (PPL) CLIA Kit
20-abx495434	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Periplakin (PPL) Protein
20-abx068469	Abbexa	EUR 732.00 EUR 286.00 EUR 2291.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Periplakin (PPL) Protein
20-abx068470	Abbexa	EUR 732.00 EUR 286.00 EUR 2291.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

ELISA kit for Mouse PPL (Periplakin)
ELK6363	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Periplakin (PPL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Periplakin (PPL). Show more
Description: A sandwich ELISA kit for detection of Periplakin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Periplakin (PPL)
KTE70706-48T	Abbkine	48T	EUR 332
Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Periplakin (PPL)
KTE70706-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Periplakin (PPL)
KTE70706-96T	Abbkine	96T	EUR 539
Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Periplakin (PPL) CLIA Kit
20-abx495435	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Periplakin (PPL) Protein
20-abx167309	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Anti-Periplakin/PPL Antibody
A02098-1	BosterBio	100ug/vial	EUR 334

Periplakin (PPL) Polyclonal Antibody (Human)
4-PAH334Hu02	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL)

Periplakin (PPL) Polyclonal Antibody (Mouse)
4-PAH334Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1501~Lys1754) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL)

Periplakin (PPL) Polyclonal Antibody (Human, Pig)
4-PAH334Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL)

Periplakin (PPL) Polyclonal Antibody (Human), APC
4-PAH334Hu02-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with APC.

Periplakin (PPL) Polyclonal Antibody (Human), Biotinylated
4-PAH334Hu02-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with Biotin.

Periplakin (PPL) Polyclonal Antibody (Human), Cy3
4-PAH334Hu02-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with Cy3.

Periplakin (PPL) Polyclonal Antibody (Human), FITC
4-PAH334Hu02-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with FITC.

Periplakin (PPL) Polyclonal Antibody (Human), HRP
4-PAH334Hu02-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with HRP.

Periplakin (PPL) Polyclonal Antibody (Human), PE
4-PAH334Hu02-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with PE.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), APC
4-PAH334Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with APC.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAH334Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with Biotin.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), Cy3
4-PAH334Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with Cy3.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), FITC
4-PAH334Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with FITC.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), HRP
4-PAH334Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with HRP.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), PE
4-PAH334Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with PE.

Periplakin (PPL) Polyclonal Antibody (Human), APC-Cy7
4-PAH334Hu02-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with APC-Cy7.

Periplakin (PPL) Polyclonal Antibody (Mouse), APC
4-PAH334Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1501~Lys1754) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with APC.

Periplakin (PPL) Polyclonal Antibody (Mouse), Biotinylated
4-PAH334Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1501~Lys1754) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with Biotin.

Periplakin (PPL) Polyclonal Antibody (Mouse), Cy3
4-PAH334Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1501~Lys1754) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with Cy3.

Periplakin (PPL) Polyclonal Antibody (Mouse), FITC
4-PAH334Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1501~Lys1754) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with FITC.

Periplakin (PPL) Polyclonal Antibody (Mouse), HRP
4-PAH334Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1501~Lys1754) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with HRP.

Periplakin (PPL) Polyclonal Antibody (Mouse), PE
4-PAH334Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1501~Lys1754) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with PE.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAH334Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1439~Gly1716) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with APC-Cy7.

Periplakin (PPL) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH334Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPL (Glu1501~Lys1754) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with APC-Cy7.

Periplakin Antibody
20-abx141927	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Periplakin antibody
70R-2652	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Periplakin antibody raised against the middle region of PPL

Periplakin antibody
PAab10072	Lifescience Market	100 ug	EUR 386

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

PPL siRNA
20-abx929423	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PPL siRNA
20-abx929424	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PPL Antibody
39987-100ul	SAB	100ul	EUR 390

PPL antibody
20R-2607	Fitzgerald	100 uL	EUR 571
Description: Guinea Pig polyclonal Periplakin antibody

anti- Periplakin antibody
FNab10072	FN Test	100µg	EUR 548.75
Recommended dilution: IHC: 1:20-1:200 Immunogen: periplakin Uniprot ID: O60437 Gene ID: 5493 Research Area: Immunology, Signal Transduction
Description: Antibody raised against Periplakin

Periplakin Blocking Peptide
33R-2523	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPL antibody, catalog no. 70R-2652

Human PPL shRNA Plasmid
20-abx953679	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PPL cloning plasmid
CSB-CL018488HU-10ug	Cusabio	10ug	EUR 2770
Formulation: 10 μg plasmid + 200μl Glycerol Length: 5271 Sequence: ATGAACTCGCTCTTCAGGAAGAGAAACAAAGGCAAATACAGCCCCACTGTGCAGACCCGGAGCATCTCTAACAAGGAGCTCTCGGAGCTGATCGAGCAGCTGCAGAAGAATGCCGACCAGGTGGAGAAGAACATCGTGGACACAGAGGCCAAGATGCAGAGTGACCTGGCTCGGC Show more
Description: A cloning plasmid for the PPL gene.

PPL Rabbit pAb
A14051-100ul	Abclonal	100 ul	EUR 308

PPL Rabbit pAb
A14051-200ul	Abclonal	200 ul	EUR 459

PPL Rabbit pAb
A14051-20ul	Abclonal	20 ul	EUR 183

PPL Rabbit pAb
A14051-50ul	Abclonal	50 ul	EUR 223

PPL Rabbit pAb
A6950-100ul	Abclonal	100 ul	EUR 308

PPL Rabbit pAb
A6950-200ul	Abclonal	200 ul	EUR 459

PPL Rabbit pAb
A6950-20ul	Abclonal	20 ul	EUR 183

PPL Rabbit pAb
A6950-50ul	Abclonal	50 ul	EUR 223

PPL Polyclonal Antibody
30769-100ul	SAB	100ul	EUR 252

PPL Polyclonal Antibody
30769-50ul	SAB	50ul	EUR 187

PPL Polyclonal Antibody
28423-100ul	SAB	100ul	EUR 252

PPL Polyclonal Antibody
28423-50ul	SAB	50ul	EUR 187

Anti-PPL antibody
STJ29030	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling.

Anti-PPL antibody
STJ115986	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling.

PPL ORF Vector (Human) (pORF)
ORF014135	ABM	1.0 ug DNA	EUR 354

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PPL Polyclonal Conjugated Antibody
C30769	SAB	100ul	EUR 397

PPL Polyclonal Conjugated Antibody
C28423	SAB	100ul	EUR 397

Mouse PPL shRNA Plasmid
20-abx972164	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

PPL sgRNA CRISPR Lentivector set (Human)
K1700201	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Ppl ORF Vector (Rat) (pORF)
ORF073882	ABM	1.0 ug DNA	EUR 2080

Ppl ORF Vector (Mouse) (pORF)
ORF054595	ABM	1.0 ug DNA	EUR 1572

PPL sgRNA CRISPR Lentivector (Human) (Target 1)
K1700202	ABM	1.0 ug DNA	EUR 154

PPL sgRNA CRISPR Lentivector (Human) (Target 2)
K1700203	ABM	1.0 ug DNA	EUR 154

PPL sgRNA CRISPR Lentivector (Human) (Target 3)
K1700204	ABM	1.0 ug DNA	EUR 154

PPL Protein Vector (Human) (pPB-C-His)
PV056537	ABM	500 ng	EUR 481

PPL Protein Vector (Human) (pPB-N-His)
PV056538	ABM	500 ng	EUR 481

PPL Protein Vector (Human) (pPM-C-HA)
PV056539	ABM	500 ng	EUR 481

PPL Protein Vector (Human) (pPM-C-His)
PV056540	ABM	500 ng	EUR 481

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Ppl sgRNA CRISPR Lentivector set (Mouse)
K3406501	ABM	3 x 1.0 ug	EUR 339

Ppl sgRNA CRISPR Lentivector set (Rat)
K6091101	ABM	3 x 1.0 ug	EUR 339

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

Ppl sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3406502	ABM	1.0 ug DNA	EUR 154

Ppl sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3406503	ABM	1.0 ug DNA	EUR 154

Ppl sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3406504	ABM	1.0 ug DNA	EUR 154

Ppl sgRNA CRISPR Lentivector (Rat) (Target 1)
K6091102	ABM	1.0 ug DNA	EUR 154

Ppl sgRNA CRISPR Lentivector (Rat) (Target 2)
K6091103	ABM	1.0 ug DNA	EUR 154

Ppl sgRNA CRISPR Lentivector (Rat) (Target 3)
K6091104	ABM	1.0 ug DNA	EUR 154

PPL Protein Vector (Mouse) (pPB-C-His)
PV218378	ABM	500 ng	EUR 2924

PPL Protein Vector (Mouse) (pPB-N-His)
PV218379	ABM	500 ng	EUR 2924

PPL Protein Vector (Mouse) (pPM-C-HA)
PV218380	ABM	500 ng	EUR 2924

PPL Protein Vector (Mouse) (pPM-C-His)
PV218381	ABM	500 ng	EUR 2924

PPL Protein Vector (Rat) (pPB-C-His)
PV295526	ABM	500 ng	EUR 2924

PPL Protein Vector (Rat) (pPB-N-His)
PV295527	ABM	500 ng	EUR 2924

PPL Protein Vector (Rat) (pPM-C-HA)
PV295528	ABM	500 ng	EUR 2924

PPL Protein Vector (Rat) (pPM-C-His)
PV295529	ABM	500 ng	EUR 2924

Ppl 3'UTR GFP Stable Cell Line
TU166785	ABM	1.0 ml	Ask for price

PPL 3'UTR Luciferase Stable Cell Line
TU018602	ABM	1.0 ml	EUR 1394

Ppl 3'UTR Luciferase Stable Cell Line
TU116785	ABM	1.0 ml	Ask for price

PPL 3'UTR GFP Stable Cell Line
TU068602	ABM	1.0 ml	EUR 1394

Ppl 3'UTR GFP Stable Cell Line
TU266631	ABM	1.0 ml	Ask for price

Ppl 3'UTR Luciferase Stable Cell Line
TU216631	ABM	1.0 ml	Ask for price

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PPL sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1700205	ABM	3 x 1.0 ug	EUR 376

PPL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1700206	ABM	1.0 ug DNA	EUR 167

PPL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1700207	ABM	1.0 ug DNA	EUR 167

PPL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1700208	ABM	1.0 ug DNA	EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3406505	ABM	3 x 1.0 ug	EUR 376

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6091105	ABM	3 x 1.0 ug	EUR 376

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3406506	ABM	1.0 ug DNA	EUR 167

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3406507	ABM	1.0 ug DNA	EUR 167

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3406508	ABM	1.0 ug DNA	EUR 167

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6091106	ABM	1.0 ug DNA	EUR 167

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6091107	ABM	1.0 ug DNA	EUR 167

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6091108	ABM	1.0 ug DNA	EUR 167

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit
ELA-E0121h	Lifescience Market	96 Tests	EUR 824

Human KIT/SCFR ELISA kit
LF-EK50791	Abfrontier	1×96T	EUR 648

Human Biopterin ELISA Kit
CELI-66011h	Lifescience Market	96 Tests	EUR 824

Human lipopolysaccharides ELISA Kit
CELI-66031h	Lifescience Market	96 Tests	EUR 824

Human Microlbumin ELISA Kit
abx517025-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Trypsin ELISA kit
E01T0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit
E01T0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit
E01T0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit
E01T0140-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit
E01T0140-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PPL(Periplakin) ELISA Kit