Human PPL(Periplakin) ELISA Kit

Human PPL(Periplakin) ELISA Kit

Human Periplakin (PPL) ELISA Kit

RD-PPL-Hu-48Tests 48 Tests
EUR 521

Human Periplakin (PPL) ELISA Kit

RD-PPL-Hu-96Tests 96 Tests
EUR 723

Human Periplakin (PPL) ELISA Kit

RDR-PPL-Hu-48Tests 48 Tests
EUR 544

Human Periplakin (PPL) ELISA Kit

RDR-PPL-Hu-96Tests 96 Tests
EUR 756

Mouse Periplakin (PPL) ELISA Kit

DLR-PPL-Mu-48T 48T
EUR 527
  • Should the Mouse Periplakin (PPL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Periplakin (PPL) ELISA Kit

DLR-PPL-Mu-96T 96T
EUR 688
  • Should the Mouse Periplakin (PPL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Periplakin (PPL) ELISA Kit

RD-PPL-Mu-48Tests 48 Tests
EUR 533

Mouse Periplakin (PPL) ELISA Kit

RD-PPL-Mu-96Tests 96 Tests
EUR 740

Mouse Periplakin (PPL) ELISA Kit

RDR-PPL-Mu-48Tests 48 Tests
EUR 557

Mouse Periplakin (PPL) ELISA Kit

RDR-PPL-Mu-96Tests 96 Tests
EUR 774

Human Periplakin, PPL ELISA KIT

ELI-15152h 96 Tests
EUR 824

Human Periplakin (PPL) ELISA Kit

20-abx152709
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Periplakin(PPL)ELISA Kit

QY-E02006 96T
EUR 361

Human Periplakin (PPL) ELISA Kit

SEH334Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Periplakin (PPL) ELISA Kit

SEH334Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Periplakin (PPL) ELISA Kit

SEH334Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Periplakin (PPL) ELISA Kit

SEH334Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Periplakin (PPL) ELISA Kit

4-SEH334Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Periplakin elisa. Alternative names of the recognized antigen: 190 kDa paraneoplastic pemphigus antigen
  • 195 kDa cornified envelope precursor protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Periplakin, Ppl ELISA KIT

ELI-35659m 96 Tests
EUR 865

Mouse Periplakin (PPL) ELISA Kit

20-abx154532
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Periplakin(PPL)ELISA Kit

QY-E21728 96T
EUR 374

Mouse Periplakin (PPL) ELISA Kit

SEH334Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Periplakin (PPL) ELISA Kit

SEH334Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Periplakin (PPL) ELISA Kit

SEH334Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Periplakin (PPL) ELISA Kit

SEH334Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Periplakin (PPL) ELISA Kit

4-SEH334Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Periplakin elisa. Alternative names of the recognized antigen: 190 kDa paraneoplastic pemphigus antigen
  • 195 kDa cornified envelope precursor protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Periplakin (PPL) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Periplakin (PPL) Antibody

20-abx129708
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periplakin (PPL) Antibody

abx038117-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Periplakin (PPL) Antibody

20-abx100391
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periplakin (PPL) Antibody

20-abx100392
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periplakin (PPL) Antibody

20-abx005273
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Periplakin (PPL) Antibody

20-abx177959
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Periplakin (PPL)

4-RPH334Hu01
  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60437
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Periplakin expressed in: E.coli

Recombinant Periplakin (PPL)

4-RPH334Hu02
  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60437
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 64.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Periplakin expressed in: E.coli

Recombinant Periplakin (PPL)

4-RPH334Mu01
  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9R269
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.1kDa
  • Isoelectric Point: 6
Description: Recombinant Mouse Periplakin expressed in: E.coli

ELISA kit for Human PPL (Periplakin)

ELK3840 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Periplakin (PPL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Periplakin (PPL).
  • Show more
Description: A sandwich ELISA kit for detection of Periplakin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Periplakin (PPL) CLIA Kit

20-abx495434
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Periplakin (PPL) Protein

20-abx068469
  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Periplakin (PPL) Protein

20-abx068470
  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

ELISA kit for Mouse PPL (Periplakin)

ELK6363 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Periplakin (PPL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Periplakin (PPL).
  • Show more
Description: A sandwich ELISA kit for detection of Periplakin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Periplakin (PPL)

KTE70706-48T 48T
EUR 332
  • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Periplakin (PPL)

KTE70706-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Periplakin (PPL)

KTE70706-96T 96T
EUR 539
  • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Periplakin (PPL) CLIA Kit

20-abx495435
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Periplakin (PPL) Protein

20-abx167309
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anti-Periplakin/PPL Antibody

A02098-1 100ug/vial
EUR 334

Periplakin (PPL) Polyclonal Antibody (Human)

4-PAH334Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL)

Periplakin (PPL) Polyclonal Antibody (Mouse)

4-PAH334Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL)

Periplakin (PPL) Polyclonal Antibody (Human, Pig)

4-PAH334Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL)

Periplakin (PPL) Polyclonal Antibody (Human), APC

4-PAH334Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with APC.

Periplakin (PPL) Polyclonal Antibody (Human), Biotinylated

4-PAH334Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with Biotin.

Periplakin (PPL) Polyclonal Antibody (Human), Cy3

4-PAH334Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with Cy3.

Periplakin (PPL) Polyclonal Antibody (Human), FITC

4-PAH334Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with FITC.

Periplakin (PPL) Polyclonal Antibody (Human), HRP

4-PAH334Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with HRP.

Periplakin (PPL) Polyclonal Antibody (Human), PE

4-PAH334Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with PE.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), APC

4-PAH334Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with APC.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), Biotinylated

4-PAH334Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with Biotin.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), Cy3

4-PAH334Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with Cy3.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), FITC

4-PAH334Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with FITC.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), HRP

4-PAH334Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with HRP.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), PE

4-PAH334Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with PE.

Periplakin (PPL) Polyclonal Antibody (Human), APC-Cy7

4-PAH334Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with APC-Cy7.

Periplakin (PPL) Polyclonal Antibody (Mouse), APC

4-PAH334Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with APC.

Periplakin (PPL) Polyclonal Antibody (Mouse), Biotinylated

4-PAH334Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with Biotin.

Periplakin (PPL) Polyclonal Antibody (Mouse), Cy3

4-PAH334Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with Cy3.

Periplakin (PPL) Polyclonal Antibody (Mouse), FITC

4-PAH334Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with FITC.

Periplakin (PPL) Polyclonal Antibody (Mouse), HRP

4-PAH334Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with HRP.

Periplakin (PPL) Polyclonal Antibody (Mouse), PE

4-PAH334Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with PE.

Periplakin (PPL) Polyclonal Antibody (Human, Pig), APC-Cy7

4-PAH334Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with APC-Cy7.

Periplakin (PPL) Polyclonal Antibody (Mouse), APC-Cy7

4-PAH334Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with APC-Cy7.

Periplakin Antibody

20-abx141927
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Periplakin antibody

70R-2652 50 ug
EUR 467
Description: Rabbit polyclonal Periplakin antibody raised against the middle region of PPL

Periplakin antibody

PAab10072 100 ug
EUR 386

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

PPL siRNA

20-abx929423
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PPL siRNA

20-abx929424
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PPL Antibody

39987-100ul 100ul
EUR 390

PPL antibody

20R-2607 100 uL
EUR 571
Description: Guinea Pig polyclonal Periplakin antibody

anti- Periplakin antibody

FNab10072 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: periplakin
  • Uniprot ID: O60437
  • Gene ID: 5493
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against Periplakin

Periplakin Blocking Peptide

33R-2523 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPL antibody, catalog no. 70R-2652

Human PPL shRNA Plasmid

20-abx953679
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PPL cloning plasmid

CSB-CL018488HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5271
  • Sequence: ATGAACTCGCTCTTCAGGAAGAGAAACAAAGGCAAATACAGCCCCACTGTGCAGACCCGGAGCATCTCTAACAAGGAGCTCTCGGAGCTGATCGAGCAGCTGCAGAAGAATGCCGACCAGGTGGAGAAGAACATCGTGGACACAGAGGCCAAGATGCAGAGTGACCTGGCTCGGC
  • Show more
Description: A cloning plasmid for the PPL gene.

PPL Rabbit pAb

A14051-100ul 100 ul
EUR 308

PPL Rabbit pAb

A14051-200ul 200 ul
EUR 459

PPL Rabbit pAb

A14051-20ul 20 ul
EUR 183

PPL Rabbit pAb

A14051-50ul 50 ul
EUR 223

PPL Rabbit pAb

A6950-100ul 100 ul
EUR 308

PPL Rabbit pAb

A6950-200ul 200 ul
EUR 459

PPL Rabbit pAb

A6950-20ul 20 ul
EUR 183

PPL Rabbit pAb

A6950-50ul 50 ul
EUR 223

PPL Polyclonal Antibody

30769-100ul 100ul
EUR 252

PPL Polyclonal Antibody

30769-50ul 50ul
EUR 187

PPL Polyclonal Antibody

28423-100ul 100ul
EUR 252

PPL Polyclonal Antibody

28423-50ul 50ul
EUR 187

Anti-PPL antibody

STJ29030 100 µl
EUR 277
Description: The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling.

Anti-PPL antibody

STJ115986 100 µl
EUR 277
Description: The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling.

PPL ORF Vector (Human) (pORF)

ORF014135 1.0 ug DNA
EUR 354

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PPL Polyclonal Conjugated Antibody

C30769 100ul
EUR 397

PPL Polyclonal Conjugated Antibody

C28423 100ul
EUR 397

Mouse PPL shRNA Plasmid

20-abx972164
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

PPL sgRNA CRISPR Lentivector set (Human)

K1700201 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Ppl ORF Vector (Rat) (pORF)

ORF073882 1.0 ug DNA
EUR 2080

Ppl ORF Vector (Mouse) (pORF)

ORF054595 1.0 ug DNA
EUR 1572

PPL sgRNA CRISPR Lentivector (Human) (Target 1)

K1700202 1.0 ug DNA
EUR 154

PPL sgRNA CRISPR Lentivector (Human) (Target 2)

K1700203 1.0 ug DNA
EUR 154

PPL sgRNA CRISPR Lentivector (Human) (Target 3)

K1700204 1.0 ug DNA
EUR 154

PPL Protein Vector (Human) (pPB-C-His)

PV056537 500 ng
EUR 481

PPL Protein Vector (Human) (pPB-N-His)

PV056538 500 ng
EUR 481

PPL Protein Vector (Human) (pPM-C-HA)

PV056539 500 ng
EUR 481

PPL Protein Vector (Human) (pPM-C-His)

PV056540 500 ng
EUR 481

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Ppl sgRNA CRISPR Lentivector set (Mouse)

K3406501 3 x 1.0 ug
EUR 339

Ppl sgRNA CRISPR Lentivector set (Rat)

K6091101 3 x 1.0 ug
EUR 339

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Ppl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3406502 1.0 ug DNA
EUR 154

Ppl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3406503 1.0 ug DNA
EUR 154

Ppl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3406504 1.0 ug DNA
EUR 154

Ppl sgRNA CRISPR Lentivector (Rat) (Target 1)

K6091102 1.0 ug DNA
EUR 154

Ppl sgRNA CRISPR Lentivector (Rat) (Target 2)

K6091103 1.0 ug DNA
EUR 154

Ppl sgRNA CRISPR Lentivector (Rat) (Target 3)

K6091104 1.0 ug DNA
EUR 154

PPL Protein Vector (Mouse) (pPB-C-His)

PV218378 500 ng
EUR 2924

PPL Protein Vector (Mouse) (pPB-N-His)

PV218379 500 ng
EUR 2924

PPL Protein Vector (Mouse) (pPM-C-HA)

PV218380 500 ng
EUR 2924

PPL Protein Vector (Mouse) (pPM-C-His)

PV218381 500 ng
EUR 2924

PPL Protein Vector (Rat) (pPB-C-His)

PV295526 500 ng
EUR 2924

PPL Protein Vector (Rat) (pPB-N-His)

PV295527 500 ng
EUR 2924

PPL Protein Vector (Rat) (pPM-C-HA)

PV295528 500 ng
EUR 2924

PPL Protein Vector (Rat) (pPM-C-His)

PV295529 500 ng
EUR 2924

Ppl 3'UTR GFP Stable Cell Line

TU166785 1.0 ml Ask for price

PPL 3'UTR Luciferase Stable Cell Line

TU018602 1.0 ml
EUR 1394

Ppl 3'UTR Luciferase Stable Cell Line

TU116785 1.0 ml Ask for price

PPL 3'UTR GFP Stable Cell Line

TU068602 1.0 ml
EUR 1394

Ppl 3'UTR GFP Stable Cell Line

TU266631 1.0 ml Ask for price

Ppl 3'UTR Luciferase Stable Cell Line

TU216631 1.0 ml Ask for price

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PPL sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1700205 3 x 1.0 ug
EUR 376

PPL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1700206 1.0 ug DNA
EUR 167

PPL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1700207 1.0 ug DNA
EUR 167

PPL sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1700208 1.0 ug DNA
EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3406505 3 x 1.0 ug
EUR 376

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6091105 3 x 1.0 ug
EUR 376

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3406506 1.0 ug DNA
EUR 167

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3406507 1.0 ug DNA
EUR 167

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3406508 1.0 ug DNA
EUR 167

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6091106 1.0 ug DNA
EUR 167

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6091107 1.0 ug DNA
EUR 167

Ppl sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6091108 1.0 ug DNA
EUR 167

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit

ELA-E0121h 96 Tests
EUR 824

Human KIT/SCFR ELISA kit

LF-EK50791 1×96T
EUR 648

Human Biopterin ELISA Kit

CELI-66011h 96 Tests
EUR 824

Human lipopolysaccharides ELISA Kit

CELI-66031h 96 Tests
EUR 824

Human Microlbumin ELISA Kit

abx517025-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Trypsin ELISA kit

E01T0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit

E01T0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit

E01T0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit

E01T0140-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit

E01T0140-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PPL(Periplakin) ELISA Kit