Human PML(Promyelocytic Leukemia Protein) ELISA Kit
Human Promyelocytic Leukemia Protein (PML) ELISA Kit |
RD-PML-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Promyelocytic Leukemia Protein (PML) ELISA Kit |
20-abx152792 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Promyelocytic Leukemia Protein (PML) ELISA Kit |
abx595499-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Human Promyelocytic Leukemia Protein (PML) ELISA Kit |
SEC221Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids. |
Human Promyelocytic Leukemia Protein (PML) ELISA Kit |
SEC221Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids. |
Human Promyelocytic Leukemia Protein (PML) ELISA Kit |
SEC221Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids. |
Human Promyelocytic Leukemia Protein (PML) ELISA Kit |
SEC221Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids. |
Human Promyelocytic Leukemia Protein (PML) ELISA Kit |
4-SEC221Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Promyelocytic Leukemia Protein elisa. Alternative names of the recognized antigen: MYL
- RNF71
- TRIM19
- Probable Transcription Factor PML
- Ring Finger Protein 71
- Tripartite motif-containing protein 19
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Promyelocytic Leukemia Protein (PML) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Promyelocytic Leukemia Protein (PML) Antibody |
20-abx008856 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Promyelocytic Leukemia Protein (PML) Antibody |
20-abx103063 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Promyelocytic Leukemia Protein (PML) Antibody |
abx117056-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Promyelocytic Leukemia Protein (PML) Antibody |
20-abx174197 |
Abbexa |
-
EUR 342.00
-
EUR 857.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Promyelocytic Leukemia Protein (PML) Antibody |
abx236572-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Promyelocytic Leukemia Protein (PML) Antibody |
20-abx324818 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Promyelocytic Leukemia Protein (PML) Antibody |
20-abx001098 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Recombinant Promyelocytic Leukemia Protein (PML) |
4-RPC221Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P29590
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Promyelocytic Leukemia Protein expressed in: E.coli |
Human Promyelocytic Leukemia Protein (PML) Protein |
20-abx068694 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Promyelocytic Leukemia Protein (PML) CLIA Kit |
20-abx493551 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human PML (Promyelocytic Leukemia Protein) |
ELK3769 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Promyelocytic Leukemia Protein (PML). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Promyelocytic Leukemia Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Promyelocytic Leukemia Protein (PML) Antibody (Biotin) |
20-abx272262 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Promyelocytic Leukemia Protein (PML) Antibody (FITC) |
20-abx273636 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human) |
4-PAC221Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PML (Gln59~Glu239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML) |
Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), APC |
4-PAC221Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PML (Gln59~Glu239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with APC. |
Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), Biotinylated |
4-PAC221Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PML (Gln59~Glu239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with Biotin. |
Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), Cy3 |
4-PAC221Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PML (Gln59~Glu239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with Cy3. |
Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), FITC |
4-PAC221Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PML (Gln59~Glu239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with FITC. |
Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), HRP |
4-PAC221Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PML (Gln59~Glu239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with HRP. |
Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), PE |
4-PAC221Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PML (Gln59~Glu239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with PE. |
Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC221Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PML (Gln59~Glu239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with APC-Cy7. |
HL60 Cell Lysate (Human promyelocytic leukemia cell line) |
LF-R0009 |
Abfrontier |
200 ul |
EUR 86 |
Description: HL60 (Human promyelocytic leukemia cell line) Whole Cell Lysate |
ELISA kit for Mouse Protein PML (PML) |
KTE70720-48T |
Abbkine |
48T |
EUR 332 |
- Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein PML (PML) |
KTE70720-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein PML (PML) |
KTE70720-96T |
Abbkine |
96T |
EUR 539 |
- Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
anti-PML Protein |
YF-PA24405 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PML Protein |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
PML Colorimetric Cell-Based ELISA Kit |
EKC1477 |
BosterBio |
100ul |
EUR 572 |
PML antibody |
70R-30724 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal PML antibody |
PML Antibody |
32211-100ul |
SAB |
100ul |
EUR 252 |
PML antibody |
10R-1742 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal PML antibody |
PML Antibody |
1-CSB-PA003823 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against PML. Recognizes PML from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
PML Antibody |
DF6318 |
Affbiotech |
200ul |
EUR 304 |
Description: PML Antibody detects endogenous levels of total PML. |
PML Antibody |
CSB-PA018236KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
PML Antibody |
CSB-PA018236KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
PML antibody |
70R-50222 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal PML antibody |
PML antibody |
70R-7965 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal PML antibody |
PML siRNA |
20-abx929039 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PML siRNA |
20-abx929040 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-PML Protein Antibody |
PB10084 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-PML Protein Antibody |
PB10085 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-PML Protein (1D12) |
YF-MA10708 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PML Protein |
Anti-PML Protein (2B10) |
YF-MA14783 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PML Protein |
Human PML shRNA Plasmid |
20-abx953606 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
PML Blocking Peptide |
33R-2443 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PML antibody, catalog no. 70R-7965 |
PML Polyclonal Antibody |
41354-100ul |
SAB |
100ul |
EUR 252 |
PML Polyclonal Antibody |
41354-50ul |
SAB |
50ul |
EUR 187 |
PML Blocking Peptide |
DF6318-BP |
Affbiotech |
1mg |
EUR 195 |
PML / RARA Antibody |
20-abx007137 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
PML Blocking Peptide |
20-abx063097 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PML Conjugated Antibody |
C32211 |
SAB |
100ul |
EUR 397 |
PML cloning plasmid |
CSB-CL018236HU-10ug |
Cusabio |
10ug |
EUR 766 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2346
- Sequence: atggagcctgcacccgcccgatctccgaggccccagcaggaccccgcccggccccaggagcccaccatgcctccccccgagaccccctctgaaggccgccagcccagccccagccccagccctacagagcgagcccccgcttcggaggaggagttccagtttctgcgctgccagc
- Show more
|
Description: A cloning plasmid for the PML gene. |
PML Polyclonal Antibody |
ABP52240-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110 |
PML Polyclonal Antibody |
ABP52240-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110 |
PML Polyclonal Antibody |
ABP52240-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110 |
PML Rabbit mAb |
A19646-100ul |
Abclonal |
100 ul |
EUR 410 |
PML Rabbit mAb |
A19646-200ul |
Abclonal |
200 ul |
EUR 571 |
PML Rabbit mAb |
A19646-20ul |
Abclonal |
20 ul |
EUR 221 |
PML Rabbit mAb |
A19646-50ul |
Abclonal |
50 ul |
EUR 287 |
anti- PML antibody |
FNab06572 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: promyelocytic leukemia
- Uniprot ID: P29590
- Gene ID: 5371
- Research Area: Immunology, Metabolism
|
Description: Antibody raised against PML |
PML Polyclonal Antibody |
ES3239-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
PML Polyclonal Antibody |
ES3239-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Anti-PML antibody |
STJ25034 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. |
Anti-PML antibody |
STJ95166 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PML. |
HL-60 Cell Slide (Human (36yrs, Female) peripheral blood promyeloblast, acute promyelocytic leukemia) (5 slides/pk) |
HCLS-17009 |
Alpha Diagnostics |
1 pk |
EUR 250 |
PML ORF Vector (Human) (pORF) |
ORF007965 |
ABM |
1.0 ug DNA |
EUR 95 |
PML Protein Vector (Human) (pPB-C-His) |
PV031857 |
ABM |
500 ng |
EUR 329 |
PML Protein Vector (Human) (pPB-N-His) |
PV031858 |
ABM |
500 ng |
EUR 329 |
PML Protein Vector (Human) (pPM-C-HA) |
PV031859 |
ABM |
500 ng |
EUR 329 |
PML Protein Vector (Human) (pPM-C-His) |
PV031860 |
ABM |
500 ng |
EUR 329 |
Human Leukemia Inhibitory Factor ELISA kit |
E01L0007-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukemia Inhibitory Factor ELISA kit |
E01L0007-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukemia Inhibitory Factor ELISA kit |
E01L0007-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukemia- associated protein 7, DLEU7 ELISA KIT |
ELI-14461h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Leukemia- associated protein 2, DLEU2 ELISA KIT |
ELI-16219h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Leukemia- associated protein 1, DLEU1 ELISA KIT |
ELI-31615h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Megakaryocytic Acute Leukemia Protein (MKL1) ELISA Kit |
abx381459-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Human PML- RARA- regulated adapter molecule 1, PRAM1 ELISA KIT |
ELI-22264h |
Lifescience Market |
96 Tests |
EUR 824 |
Human PML-RARA-regulated adapter molecule 1 (PRAM1) ELISA Kit |
abx382446-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
PML/RARA Polyclonal Antibody |
30953-100ul |
SAB |
100ul |
EUR 252 |
PML/RARA Polyclonal Antibody |
30953-50ul |
SAB |
50ul |
EUR 187 |
Polyclonal PML polyclonal antibody |
AMR09397G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PML polyclonal . This antibody is tested and proven to work in the following applications: |
Mouse PML shRNA Plasmid |
20-abx972115 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PML/RARA Rabbit pAb |
A7525-100ul |
Abclonal |
100 ul |
EUR 308 |
PML/RARA Rabbit pAb |
A7525-200ul |
Abclonal |
200 ul |
EUR 459 |
PML/RARA Rabbit pAb |
A7525-20ul |
Abclonal |
20 ul |
EUR 183 |
PML/RARA Rabbit pAb |
A7525-50ul |
Abclonal |
50 ul |
EUR 223 |
ELISA kit for Human Leukemia-associated protein 7 (DLEU7) |
KTE62031-48T |
Abbkine |
48T |
EUR 332 |
- Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Leukemia-associated protein 7 (DLEU7) |
KTE62031-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Leukemia-associated protein 7 (DLEU7) |
KTE62031-96T |
Abbkine |
96T |
EUR 539 |
- Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Leukemia-associated protein 1 (DLEU1) |
KTE62032-48T |
Abbkine |
48T |
EUR 332 |
- Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Leukemia-associated protein 1 (DLEU1) |
KTE62032-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Leukemia-associated protein 1 (DLEU1) |
KTE62032-96T |
Abbkine |
96T |
EUR 539 |
- Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
PML sgRNA CRISPR Lentivector set (Human) |
K1673401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Leukemia inhibitory factor,LIF ELISA kit |
201-12-1112 |
SunredBio |
96 tests |
EUR 440 |
- This Leukemia inhibitory factor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human thymus-leukemia antigen,TLa ELISA Kit |
201-12-1646 |
SunredBio |
96 tests |
EUR 440 |
- This thymus-leukemia antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Leukemia Inhibitory Factor (LIF) ELISA Kit |
DLR-LIF-Hu-48T |
DL Develop |
48T |
EUR 380 |
- Should the Human Leukemia Inhibitory Factor (LIF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukemia Inhibitory Factor (LIF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Leukemia Inhibitory Factor (LIF) ELISA Kit |
DLR-LIF-Hu-96T |
DL Develop |
96T |
EUR 485 |
- Should the Human Leukemia Inhibitory Factor (LIF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukemia Inhibitory Factor (LIF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Leukemia inhibitory factor, LIF ELISA kit |
CSB-E04651h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Leukemia inhibitory factor, LIF in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Leukemia inhibitory factor, LIF ELISA kit |
1-CSB-E04651h |
Cusabio |
-
EUR 574.00
-
EUR 4013.00
-
EUR 2138.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Leukemia inhibitory factor, LIF in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Leukemia inhibitory factor receptor ELISA kit |
E01L0235-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Leukemia inhibitory factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human PML(Promyelocytic Leukemia Protein) ELISA Kit