Human OSTN(Osteocrin) ELISA Kit

Human OSTN(Osteocrin) ELISA Kit

Human Osteocrin (OSTN) ELISA Kit
RDR-OSTN-Hu-48Tests 48 Tests
EUR 544

Human Osteocrin (OSTN) ELISA Kit
RDR-OSTN-Hu-96Tests 96 Tests
EUR 756

Human Osteocrin (OSTN) ELISA Kit
RD-OSTN-Hu-48Tests 48 Tests
EUR 521

Human Osteocrin (OSTN) ELISA Kit
RD-OSTN-Hu-96Tests 96 Tests
EUR 723

Rat Osteocrin (OSTN) ELISA Kit
DLR-OSTN-Ra-48T 48T
EUR 549
  • Should the Rat Osteocrin (OSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Osteocrin (OSTN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Osteocrin (OSTN) ELISA Kit
DLR-OSTN-Ra-96T 96T
EUR 718
  • Should the Rat Osteocrin (OSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Osteocrin (OSTN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Osteocrin (OSTN) ELISA Kit
RDR-OSTN-Ra-48Tests 48 Tests
EUR 583

Rat Osteocrin (OSTN) ELISA Kit
RDR-OSTN-Ra-96Tests 96 Tests
EUR 811

Rat Osteocrin (OSTN) ELISA Kit
RD-OSTN-Ra-48Tests 48 Tests
EUR 557

Rat Osteocrin (OSTN) ELISA Kit
RD-OSTN-Ra-96Tests 96 Tests
EUR 775

Human Osteocrin (OSTN) ELISA Kit
20-abx152601
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human OSTN(Osteocrin) ELISA Kit
EH4069 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human osteocrin, Ostn ELISA kit
CSB-E12021h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human osteocrin, Ostn in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human osteocrin, Ostn ELISA kit
1-CSB-E12021h
  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human osteocrin, Ostn in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Osteocrin, OSTN ELISA KIT
ELI-35196h 96 Tests
EUR 824

Human Osteocrin ELISA Kit (OSTN)
RK01995 96 Tests
EUR 521

Human Osteocrin (OSTN) ELISA Kit
SEH492Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteocrin (OSTN) in serum, plasma, tissue homogenates and other biological fluids.

Human Osteocrin (OSTN) ELISA Kit
SEH492Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteocrin (OSTN) in serum, plasma, tissue homogenates and other biological fluids.

Human Osteocrin (OSTN) ELISA Kit
SEH492Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteocrin (OSTN) in serum, plasma, tissue homogenates and other biological fluids.

Human Osteocrin (OSTN) ELISA Kit
SEH492Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteocrin (OSTN) in serum, plasma, tissue homogenates and other biological fluids.

Human Osteocrin (OSTN) ELISA Kit
4-SEH492Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Osteocrin elisa. Alternative names of the recognized antigen: Musclin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Osteocrin (OSTN) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Osteocrin(OSTN) ELISA kit
CSB-EL017269MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Osteocrin (OSTN) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Osteocrin(OSTN) ELISA kit
1-CSB-EL017269MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Osteocrin(OSTN) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Osteocrin (OSTN) ELISA Kit
20-abx155932
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Osteocrin, Ostn ELISA KIT
ELI-35197m 96 Tests
EUR 865

Rat Osteocrin ELISA Kit (OSTN)
RK03863 96 Tests
EUR 521

Rat Osteocrin (OSTN) ELISA Kit
SEH492Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Osteocrin (OSTN) in serum, plasma, tissue homogenates and other biological fluids.

Rat Osteocrin (OSTN) ELISA Kit
SEH492Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Osteocrin (OSTN) in serum, plasma, tissue homogenates and other biological fluids.

Rat Osteocrin (OSTN) ELISA Kit
SEH492Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Osteocrin (OSTN) in serum, plasma, tissue homogenates and other biological fluids.

Rat Osteocrin (OSTN) ELISA Kit
SEH492Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Osteocrin (OSTN) in serum, plasma, tissue homogenates and other biological fluids.

Rat Osteocrin (OSTN) ELISA Kit
4-SEH492Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Osteocrin elisa. Alternative names of the recognized antigen: Musclin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Osteocrin (OSTN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Osteocrin (Ostn)
1-CSB-EP017269RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 21.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Osteocrin(Ostn),partial expressed in E.coli

Osteocrin (OSTN) Antibody
20-abx177880
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Osteocrin (OSTN) Antibody
20-abx177881
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Osteocrin (OSTN) Antibody
20-abx129379
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Osteocrin (OSTN) Antibody
20-abx173912
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Osteocrin (OSTN) Antibody
20-abx173913
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Osteocrin (OSTN)
4-RPH492Mu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P61364
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.6kDa
  • Isoelectric Point: 10.1
Description: Recombinant Mouse Osteocrin expressed in: E.coli

ELISA kit for Human OSTN (Osteocrin)
ELK3820 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Osteocrin (OSTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Osteocrin (OSTN).
  • Show more
Description: A sandwich ELISA kit for detection of Osteocrin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Osteocrin (OSTN) CLIA Kit
20-abx190185
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Osteocrin (OSTN)CLIA Kit
SCH492Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Osteocrin (OSTN) in serum, plasma and other biological fluids.

Human Osteocrin (OSTN)CLIA Kit
SCH492Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Osteocrin (OSTN) in serum, plasma and other biological fluids.

Human Osteocrin (OSTN)CLIA Kit
SCH492Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Osteocrin (OSTN) in serum, plasma and other biological fluids.

Human Osteocrin (OSTN)CLIA Kit
SCH492Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteocrin (OSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Osteocrin (OSTN) in serum, plasma and other biological fluids.

Human Osteocrin (OSTN) CLIA Kit
4-SCH492Hu
  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Osteocrin Clia kit. Alternative names of the recognized antigen: Musclin
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Osteocrin (OSTN)Serum, plasma and other biological fluids

Human Osteocrin (OSTN) Protein
20-abx654624
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Rat OSTN (Osteocrin)
ELK6518 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Osteocrin (OSTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Osteocrin (OSTN).
  • Show more
Description: A sandwich ELISA kit for detection of Osteocrin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Osteocrin (OSTN) CLIA Kit
20-abx495456
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Osteocrin (OSTN) Protein
20-abx167301
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Osteocrin (OSTN) Protein
20-abx654625
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Osteocrin (OSTN) Polyclonal Antibody (Mouse)
4-PAH492Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OSTN (Phe26~Gly130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteocrin (OSTN)

Osteocrin (OSTN) Polyclonal Antibody (Mouse), APC
4-PAH492Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OSTN (Phe26~Gly130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteocrin (OSTN). This antibody is labeled with APC.

Osteocrin (OSTN) Polyclonal Antibody (Mouse), Biotinylated
4-PAH492Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OSTN (Phe26~Gly130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteocrin (OSTN). This antibody is labeled with Biotin.

Osteocrin (OSTN) Polyclonal Antibody (Mouse), Cy3
4-PAH492Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OSTN (Phe26~Gly130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteocrin (OSTN). This antibody is labeled with Cy3.

Osteocrin (OSTN) Polyclonal Antibody (Mouse), FITC
4-PAH492Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OSTN (Phe26~Gly130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteocrin (OSTN). This antibody is labeled with FITC.

Osteocrin (OSTN) Polyclonal Antibody (Mouse), HRP
4-PAH492Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OSTN (Phe26~Gly130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteocrin (OSTN). This antibody is labeled with HRP.

Osteocrin (OSTN) Polyclonal Antibody (Mouse), PE
4-PAH492Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OSTN (Phe26~Gly130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteocrin (OSTN). This antibody is labeled with PE.

Osteocrin (OSTN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH492Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OSTN (Phe26~Gly130)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Osteocrin (OSTN). This antibody is labeled with APC-Cy7.

Ostn/ Rat Ostn ELISA Kit
ELI-43258r 96 Tests
EUR 886

Human Osteocrin ELISA kit
E01O0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Osteocrin ELISA kit
E01O0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Osteocrin ELISA kit
E01O0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

OSTN ELISA Kit (Human) (OKAN06144)
OKAN06144 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

OSTN ELISA Kit (Human) (OKCD09054)
OKCD09054 96 Wells
EUR 975
Description: Description of target: Recombinant Human Osteocrin;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.7pg/mL

OSTN ELISA Kit (Human) (OKDD00447)
OKDD00447 96 Wells
EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.058 ng/mL

Rat Osteocrin ELISA kit
E02O0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Osteocrin ELISA kit
E02O0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Osteocrin ELISA kit
E02O0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Osteocrin ELISA kit
E04O0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Osteocrin ELISA kit
E04O0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Osteocrin ELISA kit
E04O0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Osteocrin ELISA kit
E03O0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Osteocrin ELISA kit
E03O0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Osteocrin ELISA kit
E03O0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Osteocrin ELISA kit
E08O0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Osteocrin ELISA kit
E08O0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Osteocrin ELISA kit
E08O0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Osteocrin ELISA kit
E07O0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Osteocrin ELISA kit
E07O0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Osteocrin ELISA kit
E07O0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Osteocrin ELISA kit
E06O0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Osteocrin ELISA kit
E06O0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Osteocrin ELISA kit
E06O0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Osteocrin ELISA kit
E09O0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Osteocrin ELISA kit
E09O0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Osteocrin ELISA kit
E09O0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Osteocrin ELISA kit
E05O0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Osteocrin ELISA kit
E05O0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Osteocrin ELISA kit
E05O0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Osteocrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Osteocrin
7-05773 2µg Ask for price

Recombinant Human Osteocrin
7-05774 10µg Ask for price

Recombinant Human Osteocrin
7-05775 1mg Ask for price

OSTN ELISA Kit (Rat) (OKAN06430)
OKAN06430 96 Wells
EUR 792
Description: Description of target: involved in regulation of bone formation and mineralization [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

OSTN ELISA Kit (Mouse) (OKCA00911)
OKCA00911 96 Wells
EUR 833
Description: Description of target: Appears to modulate osteoblastic differentiation. Could also function as an autocrine and paracrine factor linked to glucose metabolism in skeletal muscle.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

OSTN ELISA Kit (Rat) (OKCD09055)
OKCD09055 96 Wells
EUR 1053
Description: Description of target: involved in regulation of bone formation and mineralization.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

OSTN ELISA Kit (Rat) (OKDD00749)
OKDD00749 96 Wells
EUR 1040
Description: Description of target: Involved in regulation of bone formation and mineralization [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.057ng/mL

OSTN Chemi-Luminescent ELISA Kit (Human) (OKCD03846)
OKCD03846 96 Wells
EUR 988
Description: Description of target: Hormone that acts as a regulator of dendritic growth in the developing cerebral cortex in response to sensory experience . Induced in the brain following membrane depolarization and inhibits dendritic branching in neurons of the developing cortex . Probably acts by binding to natriuretic peptide receptor NPR3/NPR-C, thereby preventing binding between NPR3/NPR-C and natriuretic peptides, leading to increase cGMP production .;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Osteocrin Protein
20-abx262154
  • EUR 328.00
  • EUR 5311.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

OSTN siRNA
20-abx903784
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OSTN siRNA
20-abx927438
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OSTN siRNA
20-abx927439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human OSTN shRNA Plasmid
20-abx967458
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OSTN Recombinant Protein (Human)
RP041950 100 ug Ask for price

Recombinant Human Osteocrin (N-6His)
CR03-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH8.0.

Recombinant Human Osteocrin (N-6His)
CR03-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH8.0.

Recombinant Human Osteocrin (N-6His)
CR03-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH8.0.

Recombinant Human Osteocrin (N-6His)
CR03-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH8.0.

OSTN cloning plasmid
CSB-CL017269HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 402
  • Sequence: ATGCTGGACTGGAGATTGGCAAGTGCACATTTCATCCTGGCTGTGACACTGACACTGTGGAGCTCAGGAAAAGTCCTCTCAGTAGATGTAACAACAACAGAGGCCTTTGATTCTGGAGTCATAGATGTGCAGTCAACACCCACAGTCAGGGAAGAGAAATCAGCCACTGACCTGAC
  • Show more
Description: A cloning plasmid for the OSTN gene.

OSTN ORF Vector (Human) (pORF)
ORF013984 1.0 ug DNA
EUR 354

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Recombinant (E.Coli, His-tag) Human Osteocrin
RP-868 10 ug
EUR 286

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

OSTN protein (His tag)
80R-1763 10 ug
EUR 305
Description: Purified recombinant Human OSTN protein

Rat OSTN shRNA Plasmid
20-abx990094
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse OSTN shRNA Plasmid
20-abx982417
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OSTN Recombinant Protein (Mouse)
RP159587 100 ug Ask for price

OSTN Recombinant Protein (Rat)
RP218942 100 ug Ask for price

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

OSTN sgRNA CRISPR Lentivector set (Human)
K1576101 3 x 1.0 ug
EUR 339

OSTN-AS1 ORF Vector (Human) (pORF)
ORF027303 1.0 ug DNA Ask for price

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Recombinant Human Osteocrin Protein, His, E.coli-10ug
QP12935-10ug 10ug
EUR 201

Recombinant Human Osteocrin Protein, His, E.coli-1mg
QP12935-1mg 1mg
EUR 3954

Recombinant Human Osteocrin Protein, His, E.coli-2ug
QP12935-2ug 2ug
EUR 155

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Ostn ORF Vector (Rat) (pORF)
ORF072982 1.0 ug DNA
EUR 506

Ostn ORF Vector (Mouse) (pORF)
ORF053197 1.0 ug DNA
EUR 506

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

OSTN sgRNA CRISPR Lentivector (Human) (Target 1)
K1576102 1.0 ug DNA
EUR 154

OSTN sgRNA CRISPR Lentivector (Human) (Target 2)
K1576103 1.0 ug DNA
EUR 154

OSTN sgRNA CRISPR Lentivector (Human) (Target 3)
K1576104 1.0 ug DNA
EUR 154

OSTN Protein Vector (Human) (pPB-C-His)
PV055933 500 ng
EUR 481

OSTN Protein Vector (Human) (pPB-N-His)
PV055934 500 ng
EUR 481

OSTN Protein Vector (Human) (pPM-C-HA)
PV055935 500 ng
EUR 481

OSTN Protein Vector (Human) (pPM-C-His)
PV055936 500 ng
EUR 481

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Ostn sgRNA CRISPR Lentivector set (Rat)
K7376801 3 x 1.0 ug
EUR 339

Ostn sgRNA CRISPR Lentivector set (Mouse)
K3629601 3 x 1.0 ug
EUR 339

vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

OSTN-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV739379 1.0 ug DNA Ask for price

OSTN-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV739383 1.0 ug DNA Ask for price

OSTN-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV739384 1.0 ug DNA Ask for price

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

Ostn sgRNA CRISPR Lentivector (Rat) (Target 1)
K7376802 1.0 ug DNA
EUR 154

Ostn sgRNA CRISPR Lentivector (Rat) (Target 2)
K7376803 1.0 ug DNA
EUR 154

Ostn sgRNA CRISPR Lentivector (Rat) (Target 3)
K7376804 1.0 ug DNA
EUR 154

Ostn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3629602 1.0 ug DNA
EUR 154

Ostn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3629603 1.0 ug DNA
EUR 154

Human OSTN(Osteocrin) ELISA Kit