Human NXPH1(Neurexophilin 1) ELISA Kit
Human Neurexophilin 1 (NXPH1) ELISA Kit |
RDR-NXPH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Neurexophilin 1 (NXPH1) ELISA Kit |
RD-NXPH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Neurexophilin 1 (NXPH1) ELISA Kit |
RD-NXPH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Neurexophilin 1 (NXPH1) ELISA Kit |
20-abx152490 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Neurexophilin 1 (NXPH1) ELISA Kit |
SEC672Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids. |
Human Neurexophilin 1 (NXPH1) ELISA Kit |
SEC672Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids. |
Human Neurexophilin 1 (NXPH1) ELISA Kit |
SEC672Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids. |
Human Neurexophilin 1 (NXPH1) ELISA Kit |
SEC672Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids. |
Human Neurexophilin 1 (NXPH1) ELISA Kit |
4-SEC672Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neurexophilin 1 elisa. Alternative names of the recognized antigen: NPH1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurexophilin 1 (NXPH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
NXPH1 Human, Neurexophilin 1 Human Recombinant Protein, Sf9 |
PROTP58417-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: NXPH1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 259 amino acids (22-271) and having a molecular mass of 29.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;NXPH1 is fused to 9 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques. |
Rat Neurexophilin-1 (NXPH1) ELISA Kit |
abx391681-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Neurexophilin-1 (NXPH1) ELISA Kit |
abx390007-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Neurexophilin-1 (NXPH1) Antibody |
20-abx008168 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Neurexophilin-1 (NXPH1) Antibody |
20-abx119118 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Neurexophilin 1 (NXPH1) Antibody |
20-abx128337 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neurexophilin 1 (NXPH1) Antibody |
20-abx173756 |
Abbexa |
|
|
|
Neurexophilin-1 (NXPH1) Antibody |
abx034416-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neurexophilin-1 (NXPH1) Antibody |
abx034416-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neurexophilin-1 (NXPH1) Antibody |
abx235945-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Neurexophilin 1 (NXPH1) Antibody |
20-abx328647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neurexophilin-1 (NXPH1) Antibody |
20-abx301878 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Neurexophilin 1 (NXPH1) |
4-RPC672Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P58417
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 58.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Neurexophilin 1 expressed in: E.coli |
ELISA kit for Human NXPH1 (Neurexophilin 1) |
ELK3869 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurexophilin 1 (NXPH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurexophi
- Show more
|
Description: A sandwich ELISA kit for detection of Neurexophilin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Neurexophilin 1 (NXPH1) CLIA Kit |
20-abx493828 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Neurexophilin 1 (NXPH1) Protein |
20-abx166767 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nxph1 ELISA Kit| Rat Neurexophilin-1 ELISA Kit |
EF019041 |
Lifescience Market |
96 Tests |
EUR 689 |
Nxph1 ELISA Kit| Mouse Neurexophilin-1 ELISA Kit |
EF015646 |
Lifescience Market |
96 Tests |
EUR 689 |
NXPH1 ELISA Kit| Bovine Neurexophilin-1 ELISA Kit |
EF011654 |
Lifescience Market |
96 Tests |
EUR 689 |
Anti-NXPH1/Neurexophilin 1 Antibody |
A12696 |
BosterBio |
100ul |
EUR 397 |
Description: Anti-NXPH1 Antibody |
Neurexophilin-1 (NXPH1) Antibody (HRP) |
20-abx317064 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neurexophilin-1 (NXPH1) Antibody (FITC) |
20-abx317065 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neurexophilin-1 (NXPH1) Antibody (Biotin) |
20-abx317066 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human) |
4-PAC672Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NXPH1 (Ala22~Gly271)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1) |
NXPH1 Neurexophilin 1 Human Recombinant Protein |
PROTP58417 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: NXPH1 Human Recombinant produced in E. coli is. a single polypeptide chain containing 273 amino acids (22-271) and having a molecular mass of 31kDa. NXPH1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Recombinant Human Neurexophilin-1/NXPH1 (C-6His) |
C495-10ug |
Novoprotein |
10ug |
EUR 141 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Neurexophilin-1/NXPH1 (C-6His) |
C495-1mg |
Novoprotein |
1mg |
EUR 1674 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Neurexophilin-1/NXPH1 (C-6His) |
C495-500ug |
Novoprotein |
500ug |
EUR 1115 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Neurexophilin-1/NXPH1 (C-6His) |
C495-50ug |
Novoprotein |
50ug |
EUR 303 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), APC |
4-PAC672Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NXPH1 (Ala22~Gly271)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with APC. |
Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), Biotinylated |
4-PAC672Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NXPH1 (Ala22~Gly271)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with Biotin. |
Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), Cy3 |
4-PAC672Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NXPH1 (Ala22~Gly271)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with Cy3. |
Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), FITC |
4-PAC672Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NXPH1 (Ala22~Gly271)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with FITC. |
Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), HRP |
4-PAC672Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NXPH1 (Ala22~Gly271)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with HRP. |
Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), PE |
4-PAC672Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NXPH1 (Ala22~Gly271)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with PE. |
Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC672Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NXPH1 (Ala22~Gly271)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with APC-Cy7. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Anti-Neurexophilin-3 Antibody |
A14597-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for Neurexophilin-3 Antibody (NXPH3) detection.tested for WB in Human, Mouse, Rat. |
Neurexophilin 1 Protein |
20-abx261262 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Neurexophilin-1 Polyclonal Antibody |
ABP54711-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130 |
Neurexophilin-1 Polyclonal Antibody |
ABP54711-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130 |
Neurexophilin-1 Polyclonal Antibody |
ABP54711-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130 |
Neurexophilin-1 Polyclonal Antibody |
ES5710-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Neurexophilin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Neurexophilin-1 Polyclonal Antibody |
ES5710-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Neurexophilin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Anti-Neurexophilin-1 antibody |
STJ94423 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Neurexophilin-1. |
NXPH1 Antibody |
DF4230 |
Affbiotech |
200ul |
EUR 304 |
Description: NXPH1 Antibody detects endogenous levels of total NXPH1. |
NXPH1 Antibody |
1-CSB-PA016227LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NXPH1 antibody |
70R-50970 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal NXPH1 antibody |
NXPH1 antibody |
70R-9330 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal NXPH1 antibody |
NXPH1 Antibody |
1-CSB-PA009085 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
NXPH1 siRNA |
20-abx903719 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NXPH1 siRNA |
20-abx926696 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NXPH1 siRNA |
20-abx926697 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Neurexophilin-2 (NXPH2) |
1-CSB-MP016228HU |
Cusabio |
-
EUR 293.00
-
EUR 963.00
-
EUR 409.00
-
EUR 717.00
|
|
- MW: 31.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Neurexophilin-2(NXPH2) expressed in Mammalian cell |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human NXPH1 shRNA Plasmid |
20-abx959332 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NXPH1 Recombinant Protein (Human) |
RP021991 |
ABM |
100 ug |
Ask for price |
Neurexophilin 4 antibody |
70R-4049 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Neurexophilin 4 antibody raised against the N terminal of NXPH4 |
Neurexophilin 3 antibody |
70R-4470 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Neurexophilin 3 antibody raised against the N terminal of NXPH3 |
Neurexophilin 3 antibody |
70R-4471 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Neurexophilin 3 antibody raised against the middle region of NXPH3 |
anti-Neurexophilin 3 |
YF-PA17541 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Neurexophilin 3 |
NXPH1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1471602 |
ABM |
1.0 ug DNA |
EUR 154 |
Nxph1 Blocking Peptide |
33R-5184 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Nxph1 antibody, catalog no. 70R-9330 |
NXPH1 Blocking Peptide |
DF4230-BP |
Affbiotech |
1mg |
EUR 195 |
NXPH1 Blocking Peptide |
20-abx063845 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NXPH1 cloning plasmid |
CSB-CL016227HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 816
- Sequence: atgcaggctgcgtgctggtacgtgcttttcctcctgcagcccaccgtctacttggtcacatgtgccaatttaacgaacggtggaaagtcagaacttctgaaatcaggaagcagcaaatccacactaaagcacatatggacagaaagcagcaaagacttgtctatcagccgactcct
- Show more
|
Description: A cloning plasmid for the NXPH1 gene. |
anti- NXPH1 antibody |
FNab05945 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: neurexophilin 1
- Uniprot ID: P58417
- Gene ID: 30010
- Research Area: Neuroscience
|
Description: Antibody raised against NXPH1 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
NXPH1 ORF Vector (Human) (pORF) |
ORF007331 |
ABM |
1.0 ug DNA |
EUR 95 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Neurexophilin 3 Blocking Peptide |
33R-7840 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH3 antibody, catalog no. 70R-4470 |
Neurexophilin 4 Blocking Peptide |
33R-6369 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH4 antibody, catalog no. 70R-4049 |
Neurexophilin 3 Blocking Peptide |
33R-6733 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH3 antibody, catalog no. 70R-4471 |
Neurexophilin-2 (NXPH2) Antibody |
20-abx008273 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Neurexophilin 4 (NXPH4) Antibody |
abx026137-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neurexophilin 4 (NXPH4) Antibody |
abx026137-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neurexophilin-2 (NXPH2) Antibody |
20-abx217298 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neurexophilin 3 (NXPH3) Antibody |
20-abx133519 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Neurexophilin 3 (NXPH3) Antibody |
20-abx014651 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Neurexophilin 4 (NXPH4) Antibody |
20-abx014652 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Neurexophilin 3 (NXPH3) Antibody |
abx029138-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neurexophilin 3 (NXPH3) Antibody |
abx029138-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neurexophilin 4 (NXPH4) Antibody |
20-abx330186 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neurexophilin 3 (NXPH3) Antibody |
abx331086-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Neurexophilin 3 (NXPH3) Antibody |
20-abx328392 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neurexophilin 4 (NXPH4) Antibody |
abx332816-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Neurexophilin-2 (NXPH2) Antibody |
20-abx301241 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neurexophilin-3 Polyclonal Antibody |
ABP51928-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210 |
Neurexophilin-3 Polyclonal Antibody |
ABP51928-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210 |
Neurexophilin-3 Polyclonal Antibody |
ABP51928-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210 |
Neurexophilin-4 Polyclonal Antibody |
ABP51929-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270 |
Neurexophilin-4 Polyclonal Antibody |
ABP51929-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270 |
Neurexophilin-4 Polyclonal Antibody |
ABP51929-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270 |
Neurexophilin-3 Polyclonal Antibody |
ES2927-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Neurexophilin-3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Neurexophilin-3 Polyclonal Antibody |
ES2927-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Neurexophilin-3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Neurexophilin-4 Polyclonal Antibody |
ES2928-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Neurexophilin-4 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Neurexophilin-4 Polyclonal Antibody |
ES2928-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Neurexophilin-4 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Anti-Neurexophilin-3 antibody |
STJ94424 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Neurexophilin-3. |
Anti-Neurexophilin-4 antibody |
STJ94425 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Neurexophilin-4. |
Anti-Neurexophilin 3 (4C8) |
YF-MA17693 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Neurexophilin 3 |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
NXPH1 Antibody, HRP conjugated |
1-CSB-PA016227LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NXPH1 Antibody, FITC conjugated |
1-CSB-PA016227LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NXPH1 Antibody, Biotin conjugated |
1-CSB-PA016227LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NXPH1 protein (His tag) |
80R-3672 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant NXPH1 protein (His tag) |
Mouse NXPH1 shRNA Plasmid |
20-abx971846 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NXPH1 shRNA Plasmid |
20-abx985072 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NXPH1 Recombinant Protein (Mouse) |
RP155579 |
ABM |
100 ug |
Ask for price |
NXPH1 Recombinant Protein (Rat) |
RP214922 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Nxph1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4768802 |
ABM |
1.0 ug DNA |
EUR 154 |
Nxph1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6870502 |
ABM |
1.0 ug DNA |
EUR 154 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
NXPH1 sgRNA CRISPR Lentivector set (Human) |
K1471601 |
ABM |
3 x 1.0 ug |
EUR 339 |
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Human Lipocalin-1 (LCN1) AssayMax ELISA Kit |
EL3502-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human TGF-beta-1 AssayMax ELISA Kit |
ET3102-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human PAI-1/tPA AssayMax ELISA Kit |
EP1105-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit |
EI2200-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit |
EI2301-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit |
EP1100-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Anti-NXPH3/Neurexophilin 3 Antibody |
A14597 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal NXPH3/Neurexophilin 3 Antibody. Validated in WB and tested in Human. |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit |
EC5752-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5001-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5101-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit |
EA5501-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit |
EE2702-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Glutathione Transferase zeta 1 AssayMax ELISA Kit |
EG2350-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit |
EG3928-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit |
EM5110-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit |
EH5215-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit |
EI1001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Polyclonal NXPH1 Antibody (aa77-126) |
AMM06874G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NXPH1 (aa77-126). This antibody is tested and proven to work in the following applications: |
Polyclonal NXPH1 Antibody (N-term) |
AMM06875G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NXPH1 (N-term). This antibody is tested and proven to work in the following applications: |
Nxph1 ORF Vector (Rat) (pORF) |
ORF071642 |
ABM |
1.0 ug DNA |
EUR 506 |
Nxph1 ORF Vector (Mouse) (pORF) |
ORF051861 |
ABM |
1.0 ug DNA |
EUR 506 |
NXPH1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1471603 |
ABM |
1.0 ug DNA |
EUR 154 |
NXPH1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1471604 |
ABM |
1.0 ug DNA |
EUR 154 |
NXPH1 Protein Vector (Human) (pPB-C-His) |
PV029321 |
ABM |
500 ng |
EUR 329 |
NXPH1 Protein Vector (Human) (pPB-N-His) |
PV029322 |
ABM |
500 ng |
EUR 329 |
NXPH1 Protein Vector (Human) (pPM-C-HA) |
PV029323 |
ABM |
500 ng |
EUR 329 |
NXPH1 Protein Vector (Human) (pPM-C-His) |
PV029324 |
ABM |
500 ng |
EUR 329 |
Recombinant Human NXPH1 Protein, His, E.coli-10ug |
QP12912-HIS-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human NXPH1 Protein, His, E.coli-20ug |
QP12912-HIS-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human NXPH1 Protein, His, E.coli-2ug |
QP12912-HIS-2ug |
EnQuireBio |
2ug |
EUR 155 |
Recombinant Human NXPH1 Protein, His, E.coli-5ug |
QP12912-HIS-5ug |
EnQuireBio |
5ug |
EUR 155 |
Recombinant Human NXPH1 Protein, His, E.coli-1mg |
QP12912-HIS-EC-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human NXPH1 Protein, His, Insect-1mg |
QP12912-HIS-INSECT-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
Rat TIMP-1 AssayMax ELISA Kit |
ERT2538-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Recombinant Human Neurexophilin-2 Protein, His, Mammal-100ug |
QP10093-ma-100ug |
EnQuireBio |
100ug |
EUR 1178 |
Recombinant Human Neurexophilin-2 Protein, His, Mammal-20ug |
QP10093-ma-20ug |
EnQuireBio |
20ug |
EUR 462 |
Recombinant Human Neurexophilin-2 Protein, His, Mammal-50ug |
QP10093-ma-50ug |
EnQuireBio |
50ug |
EUR 862 |
Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit |
EI1770-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit |
EG5001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit |
EG5101-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit |
EN2550-1 |
AssayPro |
96 Well Plate |
EUR 477 |
NXPH1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K1471606 |
ABM |
1.0 ug DNA |
EUR 167 |
Nxph1 sgRNA CRISPR Lentivector set (Mouse) |
K4768801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nxph1 sgRNA CRISPR Lentivector set (Rat) |
K6870501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayMax ELISA Kit |
EG2713-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit |
EMI2200-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Lactoferrin AssayMax ELISA Kit |
EL1011-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Leptin AssayMax ELISA Kit |
EL2001-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Lactoferrin AssayMax ELISA Kit |
EL2011-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Lysozyme AssayMax ELISA Kit |
EL3010-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Human Lysozyme AssayMax ELISA Kit |
EL3020-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Human HDHD2 AssayMax ELISA Kit |
EH2429-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human NXPH1(Neurexophilin 1) ELISA Kit