Human MUC21(Mucin 21) ELISA Kit

Human MUC21(Mucin 21) ELISA Kit

Human Mucin 21 (MUC21) ELISA Kit
RDR-MUC21-Hu-48Tests 48 Tests
EUR 544

Human Mucin 21 (MUC21) ELISA Kit
RDR-MUC21-Hu-96Tests 96 Tests
EUR 756

Human Mucin-21 (MUC21) ELISA Kit
abx571364-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human MUC21/ Mucin-21 ELISA Kit
E2808Hu 1 Kit
EUR 571

Human MUC21(Mucin-21) ELISA Kit
EH0773 96T
EUR 476.25
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q5SSG8
  • Alias: MUC21(Mucin-21)/Epiglycanin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Mucin-21 (MUC21) ELISA Kit
20-abx152397
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mucin-21 (MUC21) ELISA Kit
abx350081-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Mucin 21(MUC21)ELISA Kit
QY-E00288 96T
EUR 394

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
4-SED184Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Mucin 21 elisa. Alternative names of the recognized antigen: C6orf205
  • Epiglycanin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mucin 21 (MUC21) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mucin 21 (MUC21) Antibody
20-abx173626
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mucin 21 (MUC21) Antibody
20-abx177617
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Recombinant Mucin 21 (MUC21)
4-RPD184Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5SSG8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 10.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Mucin 21 expressed in: E.coli

Rabbit Mucin-21 (MUC21) ELISA Kit
abx363691-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Mucin-21 (MUC21) ELISA Kit
abx364248-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Monkey Mucin-21 (MUC21) ELISA Kit
abx358770-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Chicken Mucin-21 (MUC21) ELISA Kit
abx355863-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Mucin 21 (MUC21) Protein
20-abx652213
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Mucin-21 (MUC21) CLIA Kit
20-abx494127
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Mucin 21 (MUC21) CLIA Kit
abx197308-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Human MUC21 (Mucin 21)
ELK4073 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mucin 21 (MUC21). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mucin 21 (MUC21).
  • Show more
Description: A sandwich ELISA kit for detection of Mucin 21 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human MUC21 (Mucin 21)
E-EL-H0696 1 plate of 96 wells
EUR 377
  • Gentaur's MUC21 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MUC21. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MUC21 (Mucin 21) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Mucin-21 (MUC21)
KTE61456-48T 48T
EUR 332
  • MUC21 encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in i
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-21 (MUC21) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-21 (MUC21)
KTE61456-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MUC21 encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in i
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-21 (MUC21) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-21 (MUC21)
KTE61456-96T 96T
EUR 539
  • MUC21 encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in i
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-21 (MUC21) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human MUC21 (Mucin 21)
E-CL-H0513 1 plate of 96 wells
EUR 584
  • Gentaur's MUC21 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MUC21 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MUC21 (Mucin 21) in samples from Serum, Plasma, Cell supernatant

Human MUC21 ELISA Kit
ELA-E0210h 96 Tests
EUR 824

MUC21 ELISA KIT|Human
EF000501 96 Tests
EUR 689

XMIR-21 RNA oligo miRNA-21-5p with Xmotif
XMIR-21 10 rxn
EUR 438
  • Category: Exosome

MUC21 ELISA Kit (Human) (OKCD08411)
OKCD08411 96 Wells
EUR 975
Description: Description of target: This gene encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. The encoded protein contains an N-terminal signal sequence, an extracellular mucin domain, a stem domain, a transmembrane domain, and a C-terminal cytoplasmic tail domain. The mucin domain contains O-glycosylation sites and is polymorphic with isoforms containing a variable number of nonidentical proline-, threonine-, and serine-rich tandem repeats of 15 amino acids each. The aberrent expression of this gene is associated with lung adenocarcinoma.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

MUC21 ELISA Kit (Human) (OKEH04157)
OKEH04157 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.98 ng/mL

AXMIR-21 RNA oligo anti-miRNA-21-5p with Xmotif
AXMIR-21 10 reactions
EUR 438
  • Category: Exosome

XMIRXpress lentivector miRNA-21-5p with Xmotif
XMIRXP-21 10 ug
EUR 677
  • Category: Exosome

MUC21 siRNA
20-abx925022
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human MUC21 shRNA Plasmid
20-abx968050
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MUC21 Recombinant Protein (Human)
RP041476 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

MUC21 cloning plasmid
CSB-CL713107HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1251
  • Sequence: ATGAAGATGCAGAAAGGAAATGTTCTCCTTATGTTTGGTCTACTATTGCATTTAGAAGCTGCAACAAATTCCAATGAGACTAGCACCTCTGCCAACACTGGATCCAGTGTGATCTCCAGTGGAGCCAGCACAGCCACCAACTCTGGGTCCAGTGTGACCTCCAGTGGGGTCAGCA
  • Show more
Description: A cloning plasmid for the MUC21 gene.

Human IL-21(Interleukin-21) ELISA Kit
EH1886 96T
EUR 524.1
  • Detection range: 62.5-4000 pg/ml
  • Uniprot ID: Q9HBE4
  • Alias: IL-21/Interleukin-21/Za11/IL21
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human Interleukin 21(IL-21)ELISA Kit
GA-E0097HM-48T 48T
EUR 289

Human Interleukin 21(IL-21)ELISA Kit
GA-E0097HM-96T 96T
EUR 466

Human Interleukin 21,IL-21 ELISA Kit
201-12-0058 96 tests
EUR 440
  • This Interleukin 21 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 21, IL-21 ELISA Kit
CSB-E11707h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 21, IL-21 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 21, IL-21 ELISA Kit
1-CSB-E11707h
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 21, IL-21 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 21(IL-21)ELISA Kit
QY-E04294 96T
EUR 374

MUC21 ORF Vector (Human) (pORF)
ORF013826 1.0 ug DNA
EUR 95

IgE (Immune globulin E) ELISA test
21 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of IgE (Immune globulin)

ELISA kit for Human IL-21 (Interleukin 21)
E-EL-H2450 1 plate of 96 wells
EUR 534
  • Gentaur's IL-21 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-21. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-21 (Interleukin 21) in samples from Serum, Plasma, Cell supernatant

Human Matrix Metalloproteinase 21(MMP-21)ELISA Kit
QY-E02991 96T
EUR 361

Human Interleukin 21 ELISA kit
E01I0028-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 21 ELISA kit
E01I0028-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 21 ELISA kit
E01I0028-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

IL-21 ELISA KIT|Human
EF006004 96 Tests
EUR 689

ARPP-21 ELISA KIT|Human
EF007917 96 Tests
EUR 689

Human IL-21 ELISA Kit
RK00041 96 Tests
EUR 521

Human FGF-21 ELISA Kit
RK00084 96 Tests
EUR 521

Human Mucin (MUC) ELISA Kit
20-abx585162
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mucin 2 ELISA kit
E01M0352-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 2 ELISA kit
E01M0352-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 2 ELISA kit
E01M0352-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit
E01M0358-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MUC21(Mucin 21) ELISA Kit