Human MTDH(Metadherin) ELISA Kit

Human MTDH(Metadherin) ELISA Kit

Human Metadherin (MTDH) ELISA Kit

RDR-MTDH-Hu-96Tests 96 Tests
EUR 756

Human Metadherin (MTDH) ELISA Kit

RD-MTDH-Hu-48Tests 48 Tests
EUR 521

Human Metadherin (MTDH) ELISA Kit

RD-MTDH-Hu-96Tests 96 Tests
EUR 723

Human Metadherin (MTDH) ELISA Kit

20-abx152312
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Metadherin (MTDH) ELISA Kit

abx250897-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Metadherin (MTDH) ELISA Kit

abx571203-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Metadherin(MTDH)ELISA Kit

QY-E00441 96T
EUR 361

Human Metadherin (MTDH) ELISA Kit

SEC631Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

Human Metadherin (MTDH) ELISA Kit

SEC631Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

Human Metadherin (MTDH) ELISA Kit

SEC631Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

Human Metadherin (MTDH) ELISA Kit

SEC631Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

Human Metadherin (MTDH) ELISA Kit

4-SEC631Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Metadherin elisa. Alternative names of the recognized antigen: 3D3
  • AEG1
  • LYRIC
  • Astrocyte elevated gene-1 protein
  • Lysine-rich CEACAM1 co-isolated protein
  • Metastasis adhesion protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Metadherin (MTDH) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Metadherin (MTDH) ELISA Kit

abx516937-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Metadherin (MTDH) ELISA Kit

abx516938-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Metadherin (MTDH) Antibody

20-abx006805
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metadherin (MTDH) Antibody

20-abx177534
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Metadherin (MTDH) Antibody

20-abx113692
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Metadherin (MTDH) Antibody

20-abx173544
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Metadherin (MTDH) Antibody

abx011143-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Metadherin (MTDH) Antibody

20-abx321360
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Human MTDH (Metadherin)

ELK3779 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Metadherin (MTDH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Metadherin (MTDH
  • Show more
Description: A sandwich ELISA kit for detection of Metadherin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Metadherin (MTDH) CLIA Kit

20-abx493810
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Metadherin (MTDH) Protein

20-abx654347
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

MTDH Metadherin Human Recombinant Protein

PROTQ86UE4 Regular: 10ug
EUR 317
Description: Metadherin Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Val271-Asn456) containing 196 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 21.5kDa.

Monoclonal MTDH / Metadherin Antibody (clone 2F11C3), Clone: 2F11C3

AMM01881G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human MTDH / Metadherin (clone 2F11C3). The antibodies are raised in Mouse and are from clone 2F11C3. This antibody is applicable in WB and IHC-P, E, Flo

Mtdh/ Rat Mtdh ELISA Kit

ELI-04711r 96 Tests
EUR 886

Human MTDH ELISA Kit

ELA-E1442h 96 Tests
EUR 824

MTDH ELISA KIT|Human

EF009612 96 Tests
EUR 689

Metadherin antibody

10R-1918 100 ul
EUR 403
Description: Mouse monoclonal Metadherin antibody

Metadherin Antibody

BF0508 200ul
EUR 376
Description: Metadherin antibody detects endogenous levels of total Metadherin.

Human MTDH/ Protein LYRIC ELISA Kit

E1650Hu 1 Kit
EUR 571

Human MTDH(Protein LYRIC) ELISA Kit

EH1606 96T
EUR 567.6
  • Detection range: 1.56-100pmol/ml
  • Uniprot ID: Q86UE4
  • Alias: MTDH(Protein LYRIC)/3D3/AEG1/LYRIC/AEG-13D3,LYRIC/AEG1LYRIC,3D3/Astrocyte elevated gene-1 protein/Metastasis adhesion protein/Lysine-rich CEACAM1 co-isolated protein/Metadherin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938pmol/ml

Human Protein LYRIC, MTDH ELISA KIT

ELI-04710h 96 Tests
EUR 824

ELISA kit for Human Protein LYRIC (MTDH)

KTE61504-48T 48T
EUR 332
  • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein LYRIC (MTDH)

KTE61504-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein LYRIC (MTDH)

KTE61504-96T 96T
EUR 539
  • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Metadherin(LYRIC) Antibody

48236-100ul 100ul
EUR 333

Metadherin(LYRIC) Antibody

48236-50ul 50ul
EUR 239

Metadherin Blocking Peptide

BF0508-BP 1mg
EUR 195

anti-Metadherin (2F11C3)

LF-MA30328 100 ul
EUR 486
Description: Mouse Monoclonal to Metadherin

MTDH Antibody

1-CSB-PA773028ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MTDH. Recognizes MTDH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

MTDH Antibody

1-CSB-PA015143GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MTDH. Recognizes MTDH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

MTDH siRNA

20-abx903370
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MTDH siRNA

20-abx924881
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MTDH siRNA

20-abx924882
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pUC19-MTDH

PVT14391 2 ug
EUR 495

Mouse Protein LYRIC, Mtdh ELISA KIT

ELI-04709m 96 Tests
EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human MTDH shRNA Plasmid

20-abx964109
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MTDH Recombinant Protein (Human)

RP020257 100 ug Ask for price

Metadherin(LYRIC) Conjugated Antibody

C48236 100ul
EUR 397

ELISA kit for Rat Protein LYRIC (MTDH)

KTE100572-48T 48T
EUR 332
  • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein LYRIC (MTDH)

KTE100572-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein LYRIC (MTDH)

KTE100572-96T 96T
EUR 539
  • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein LYRIC (MTDH)

KTE70928-48T 48T
EUR 332
  • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein LYRIC (MTDH)

KTE70928-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein LYRIC (MTDH)

KTE70928-96T 96T
EUR 539
  • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MTDH Polyclonal Antibody

30670-100ul 100ul
EUR 252

MTDH Polyclonal Antibody

30670-50ul 50ul
EUR 187

MTDH cloning plasmid

CSB-CL773028HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1749
  • Sequence: atggctgcacggagctggcaggacgagctggcccagcaggccgaggagggctcggcccggctgcgggaaatgctctcggtcggcctaggctttctgcgcaccgagctgggcctcgacctggggctggagccgaaacggtaccccggctgggtgatcctggtgggcactggcgcgc
  • Show more
Description: A cloning plasmid for the MTDH gene.

MTDH Rabbit pAb

A5887-100ul 100 ul
EUR 308

MTDH Rabbit pAb

A5887-200ul 200 ul
EUR 459

MTDH Rabbit pAb

A5887-20ul 20 ul
EUR 183

MTDH Rabbit pAb

A5887-50ul 50 ul
EUR 223

pDONR223-MTDH Plasmid

PVTB00287-1 2 ug
EUR 356

pcDNA3.1-MTDH Plasmid

PVTB00287-2a 2 ug
EUR 356

Anti-MTDH antibody

STJ29926 100 µl
EUR 277

Anti-MTDH antibody

STJ98256 100 µl
EUR 234
Description: Mouse monoclonal to MTDH.

MTDH ORF Vector (Human) (pORF)

ORF006753 1.0 ug DNA
EUR 95

Monoclonal Metadherin Antibody, Clone: 2F11C3

AMM06386G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human Metadherin. The antibodies are raised in Mouse and are from clone 2F11C3. This antibody is applicable in WB and IHC, FC, E

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Rat MTDH shRNA Plasmid

20-abx987631
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MTDH shRNA Plasmid

20-abx976005
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MTDH Polyclonal Conjugated Antibody

C30670 100ul
EUR 397

Anti-LYRIC/MTDH Antibody

PB9338 100ug/vial
EUR 334

pcDNA3.1-MTDH-HA Plasmid

PVTB00287-2b 2 ug
EUR 356

pEGFP-N1-MTDH Plasmid

PVTB00287-2c 2 ug
EUR 356

MTDH Recombinant Protein (Mouse)

RP152003 100 ug Ask for price

MTDH Recombinant Protein (Rat)

RP212633 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

MTDH sgRNA CRISPR Lentivector set (Human)

K1359401 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

AEG-1 / MTDH-Specific Antibody

abx230189-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mtdh ORF Vector (Rat) (pORF)

ORF070879 1.0 ug DNA
EUR 506

Mtdh ORF Vector (Mouse) (pORF)

ORF050669 1.0 ug DNA
EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MTDH sgRNA CRISPR Lentivector (Human) (Target 1)

K1359402 1.0 ug DNA
EUR 154

MTDH sgRNA CRISPR Lentivector (Human) (Target 2)

K1359403 1.0 ug DNA
EUR 154

MTDH sgRNA CRISPR Lentivector (Human) (Target 3)

K1359404 1.0 ug DNA
EUR 154

MTDH Protein Vector (Human) (pPB-C-His)

PV027009 500 ng
EUR 329

MTDH Protein Vector (Human) (pPB-N-His)

PV027010 500 ng
EUR 329

MTDH Protein Vector (Human) (pPM-C-HA)

PV027011 500 ng
EUR 329

MTDH Protein Vector (Human) (pPM-C-His)

PV027012 500 ng
EUR 329

Recombinant Human MTDH Protein, His, E.coli-10ug

QP12748-10ug 10ug
EUR 201

Recombinant Human MTDH Protein, His, E.coli-1mg

QP12748-1mg 1mg
EUR 5251

Recombinant Human MTDH Protein, His, E.coli-2ug

QP12748-2ug 2ug
EUR 155

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

anti- AEG-1/MTDH-Specific antibody

FNab00189 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: metadherin
  • Uniprot ID: Q86UE4
  • Gene ID: 92140
  • Research Area: Cancer
Description: Antibody raised against AEG-1/MTDH-Specific

Mtdh sgRNA CRISPR Lentivector set (Rat)

K6945301 3 x 1.0 ug
EUR 339

Anti-AEG-1/MTDH-Specific antibody

PAab00189 100 ug
EUR 355

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Mtdh sgRNA CRISPR Lentivector (Rat) (Target 1)

K6945302 1.0 ug DNA
EUR 154

Mtdh sgRNA CRISPR Lentivector (Rat) (Target 2)

K6945303 1.0 ug DNA
EUR 154

Mtdh sgRNA CRISPR Lentivector (Rat) (Target 3)

K6945304 1.0 ug DNA
EUR 154

MTDH Protein Vector (Mouse) (pPB-C-His)

PV202674 500 ng
EUR 603

MTDH Protein Vector (Mouse) (pPB-N-His)

PV202675 500 ng
EUR 603

MTDH Protein Vector (Mouse) (pPM-C-HA)

PV202676 500 ng
EUR 603

MTDH Protein Vector (Mouse) (pPM-C-His)

PV202677 500 ng
EUR 603

MTDH Protein Vector (Rat) (pPB-C-His)

PV283514 500 ng
EUR 603

MTDH Protein Vector (Rat) (pPB-N-His)

PV283515 500 ng
EUR 603

MTDH Protein Vector (Rat) (pPM-C-HA)

PV283516 500 ng
EUR 603

Human MTDH(Metadherin) ELISA Kit