Human MTDH(Metadherin) ELISA Kit
 ELISA Kit) Human Metadherin (MTDH) ELISA Kit |
|
RDR-MTDH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Metadherin (MTDH) ELISA Kit |
|
RD-MTDH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Metadherin (MTDH) ELISA Kit |
|
RD-MTDH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Metadherin (MTDH) ELISA Kit |
|
20-abx152312 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Metadherin (MTDH) ELISA Kit |
|
abx250897-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Metadherin (MTDH) ELISA Kit |
|
abx571203-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Metadherin (MTDH) ELISA Kit |
|
SEC631Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids. |
Human Metadherin (MTDH) ELISA Kit |
|
SEC631Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids. |
Human Metadherin (MTDH) ELISA Kit |
|
SEC631Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids. |
Human Metadherin (MTDH) ELISA Kit |
|
SEC631Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids. |
Human Metadherin (MTDH) ELISA Kit |
|
4-SEC631Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Metadherin elisa. Alternative names of the recognized antigen: 3D3
- AEG1
- LYRIC
- Astrocyte elevated gene-1 protein
- Lysine-rich CEACAM1 co-isolated protein
- Metastasis adhesion protein
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Metadherin (MTDH) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Antibody) Metadherin (MTDH) Antibody |
|
20-abx006805 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Metadherin (MTDH) Antibody |
|
20-abx177534 |
Abbexa |
|
|
|
|
Metadherin (MTDH) Antibody |
|
20-abx113692 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Metadherin (MTDH) Antibody |
|
20-abx173544 |
Abbexa |
|
|
|
|
Metadherin (MTDH) Antibody |
|
abx011143-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Metadherin (MTDH) Antibody |
|
20-abx321360 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 ELISA Kit) Mouse Metadherin (MTDH) ELISA Kit |
|
abx516937-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Metadherin (MTDH) ELISA Kit |
|
abx516938-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
) ELISA kit for Human MTDH (Metadherin) |
|
ELK3779 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Metadherin (MTDH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Metadherin (MTDH
- Show more
|
|
Description: A sandwich ELISA kit for detection of Metadherin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 Protein) Human Metadherin (MTDH) Protein |
|
20-abx654347 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 CLIA Kit) Human Metadherin (MTDH) CLIA Kit |
|
20-abx493810 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 MTDH Metadherin Human Recombinant Protein |
|
PROTQ86UE4 |
BosterBio |
Regular: 10ug |
EUR 317 |
|
Description: Metadherin Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Val271-Asn456) containing 196 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 21.5kDa. |
, Clone: 2F11C3) Monoclonal MTDH / Metadherin Antibody (clone 2F11C3), Clone: 2F11C3 |
|
AMM01881G |
Leading Biology |
0.05ml |
EUR 484 |
|
Description: A Monoclonal antibody against Human MTDH / Metadherin (clone 2F11C3). The antibodies are raised in Mouse and are from clone 2F11C3. This antibody is applicable in WB and IHC-P, E, Flo |
 (OKCD08210)) MTDH ELISA Kit (Human) (OKCD08210) |
|
OKCD08210 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: Metadherin (Metastasis adhesion protein), also known as MTDH, LYsine-RIch CEACAM1 co-isolated (LYRIC), is a novel protein that localizes with the tight junction proteins ZO-1 and occludin in polarized epithelial cells. At the tight junction, it acts not as a structural component, but is rather recruited during the maturation of the tight junction complex. Metadherin is overexpressed in breast cancer tissue and breast tumor xenografts, while much lower levels are expressed in normal breast tissue. Metadherin binds to lung vasculature, one of the four common sites of breast cancer metastasis, through a C-terminal segment in the extracellular domain; blocking this lung-homing domain with antibodies or inhibiting metadherin with siRNA has been reported to inhibit breast cancer metastasis.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL |
 (OKEH04866)) MTDH ELISA Kit (Human) (OKEH04866) |
|
OKEH04866 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092nmol/L |
 Metadherin antibody |
|
10R-1918 |
Fitzgerald |
100 ul |
EUR 403 |
|
Description: Mouse monoclonal Metadherin antibody |
 Metadherin Antibody |
|
BF0508 |
Affbiotech |
200ul |
EUR 376 |
|
Description: Metadherin antibody detects endogenous levels of total Metadherin. |
 Human MTDH/ Protein LYRIC ELISA Kit |
|
E1650Hu |
Sunlong |
1 Kit |
EUR 571 |
 ELISA Kit) Human MTDH(Protein LYRIC) ELISA Kit |
|
EH1606 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 1.56-100pmol/ml
- Uniprot ID: Q86UE4
- Alias: MTDH(Protein LYRIC)/3D3/AEG1/LYRIC/AEG-13D3,LYRIC/AEG1LYRIC,3D3/Astrocyte elevated gene-1 protein/Metastasis adhesion protein/Lysine-rich CEACAM1 co-isolated protein/Metadherin
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938pmol/ml |
 (OKEH05493)) MTDH ELISA Kit (Mouse) (OKEH05493) |
|
OKEH05493 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.7 pg/mL |
 (OKEH06168)) MTDH ELISA Kit (Rat) (OKEH06168) |
|
OKEH06168 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.06 pg/mL |
 Antibody) Metadherin(LYRIC) Antibody |
|
48236-100ul |
SAB |
100ul |
EUR 333 |
Metadherin(LYRIC) Antibody |
|
48236-50ul |
SAB |
50ul |
EUR 239 |
 Metadherin Blocking Peptide |
|
BF0508-BP |
Affbiotech |
1mg |
EUR 195 |
) anti-Metadherin (2F11C3) |
|
LF-MA30328 |
Abfrontier |
100 ul |
EUR 486 |
|
Description: Mouse Monoclonal to Metadherin |
) ELISA kit for Human Protein LYRIC (MTDH) |
|
KTE61504-48T |
Abbkine |
48T |
EUR 332 |
- MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein LYRIC (MTDH) |
|
KTE61504-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein LYRIC (MTDH) |
|
KTE61504-96T |
Abbkine |
96T |
EUR 539 |
- MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 MTDH Antibody |
|
1-CSB-PA773028ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against MTDH. Recognizes MTDH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000 |
MTDH Antibody |
|
1-CSB-PA015143GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against MTDH. Recognizes MTDH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
 MTDH siRNA |
|
20-abx903370 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MTDH siRNA |
|
20-abx924881 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MTDH siRNA |
|
20-abx924882 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 Human MTDH shRNA Plasmid |
|
20-abx964109 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MTDH Recombinant Protein (Human) |
|
RP020257 |
ABM |
100 ug |
Ask for price |
 Conjugated Antibody) Metadherin(LYRIC) Conjugated Antibody |
|
C48236 |
SAB |
100ul |
EUR 397 |
) ELISA kit for Rat Protein LYRIC (MTDH) |
|
KTE100572-48T |
Abbkine |
48T |
EUR 332 |
- MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Protein LYRIC (MTDH) |
|
KTE100572-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Protein LYRIC (MTDH) |
|
KTE100572-96T |
Abbkine |
96T |
EUR 539 |
- MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) ELISA kit for Mouse Protein LYRIC (MTDH) |
|
KTE70928-48T |
Abbkine |
48T |
EUR 332 |
- MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein LYRIC (MTDH) |
|
KTE70928-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein LYRIC (MTDH) |
|
KTE70928-96T |
Abbkine |
96T |
EUR 539 |
- MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 MTDH Polyclonal Antibody |
|
30670-100ul |
SAB |
100ul |
EUR 252 |
MTDH Polyclonal Antibody |
|
30670-50ul |
SAB |
50ul |
EUR 187 |
 MTDH cloning plasmid |
|
CSB-CL773028HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1749
- Sequence: atggctgcacggagctggcaggacgagctggcccagcaggccgaggagggctcggcccggctgcgggaaatgctctcggtcggcctaggctttctgcgcaccgagctgggcctcgacctggggctggagccgaaacggtaccccggctgggtgatcctggtgggcactggcgcgc
- Show more
|
|
Description: A cloning plasmid for the MTDH gene. |
 MTDH Rabbit pAb |
|
A5887-100ul |
Abclonal |
100 ul |
EUR 308 |
MTDH Rabbit pAb |
|
A5887-200ul |
Abclonal |
200 ul |
EUR 459 |
MTDH Rabbit pAb |
|
A5887-20ul |
Abclonal |
20 ul |
EUR 183 |
MTDH Rabbit pAb |
|
A5887-50ul |
Abclonal |
50 ul |
EUR 223 |
 Anti-MTDH antibody |
|
STJ98256 |
St John's Laboratory |
100 µl |
EUR 234 |
|
Description: Mouse monoclonal to MTDH. |
 (pORF)) MTDH ORF Vector (Human) (pORF) |
|
ORF006753 |
ABM |
1.0 ug DNA |
EUR 95 |
 Monoclonal Metadherin Antibody, Clone: 2F11C3 |
|
AMM06386G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A Monoclonal antibody against Human Metadherin. The antibodies are raised in Mouse and are from clone 2F11C3. This antibody is applicable in WB and IHC, FC, E |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 Rat MTDH shRNA Plasmid |
|
20-abx987631 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse MTDH shRNA Plasmid |
|
20-abx976005 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 MTDH Polyclonal Conjugated Antibody |
|
C30670 |
SAB |
100ul |
EUR 397 |
 Anti-LYRIC/MTDH Antibody |
|
PB9338 |
BosterBio |
100ug/vial |
EUR 334 |
) MTDH Recombinant Protein (Mouse) |
|
RP152003 |
ABM |
100 ug |
Ask for price |
) MTDH Recombinant Protein (Rat) |
|
RP212633 |
ABM |
100 ug |
Ask for price |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
) MTDH sgRNA CRISPR Lentivector set (Human) |
|
K1359401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
|
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
|
 AEG-1 / MTDH-Specific Antibody |
|
abx230189-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 (pORF)) Mtdh ORF Vector (Rat) (pORF) |
|
ORF070879 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Mtdh ORF Vector (Mouse) (pORF) |
|
ORF050669 |
ABM |
1.0 ug DNA |
EUR 506 |
 CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 (Target 1)) MTDH sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1359402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) MTDH sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1359403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) MTDH sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1359404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) MTDH Protein Vector (Human) (pPB-C-His) |
|
PV027009 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) MTDH Protein Vector (Human) (pPB-N-His) |
|
PV027010 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) MTDH Protein Vector (Human) (pPM-C-HA) |
|
PV027011 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) MTDH Protein Vector (Human) (pPM-C-His) |
|
PV027012 |
ABM |
500 ng |
EUR 329 |
 Recombinant Human MTDH Protein, His, E.coli-10ug |
|
QP12748-10ug |
EnQuireBio |
10ug |
EUR 201 |
 Recombinant Human MTDH Protein, His, E.coli-1mg |
|
QP12748-1mg |
EnQuireBio |
1mg |
EUR 5251 |
 Recombinant Human MTDH Protein, His, E.coli-2ug |
|
QP12748-2ug |
EnQuireBio |
2ug |
EUR 155 |
 Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 and Fast ligase (2.5ul)]) Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
|
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
|
) PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
) PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
 anti- AEG-1/MTDH-Specific antibody |
|
FNab00189 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: metadherin
- Uniprot ID: Q86UE4
- Gene ID: 92140
- Research Area: Cancer
|
|
Description: Antibody raised against AEG-1/MTDH-Specific |
) Mtdh sgRNA CRISPR Lentivector set (Rat) |
|
K6945301 |
ABM |
3 x 1.0 ug |
EUR 339 |
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
 vWF Acty. Kit |
|
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
 vWF Ant. Kit |
|
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
 (Target 1)) Mtdh sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6945302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Mtdh sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6945303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Mtdh sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6945304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) MTDH Protein Vector (Mouse) (pPB-C-His) |
|
PV202674 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) MTDH Protein Vector (Mouse) (pPB-N-His) |
|
PV202675 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) MTDH Protein Vector (Mouse) (pPM-C-HA) |
|
PV202676 |
ABM |
500 ng |
EUR 603 |
Human MTDH(Metadherin) ELISA Kit
ELISA Kit)
