Human LIPH(Lipase H) ELISA Kit
Human Lipase H (LIPH) ELISA Kit |
RDR-LIPH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human LIPH(Lipase H) ELISA Kit |
EH3297 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 1.563-100 ng/ml
- Uniprot ID: Q8WWY8
- Alias: LIPH/Phospholipase A1 member B/LPD lipase-related protein/Membrane-associated phosphatidic acid-selective phospholipase A1-alpha(mPA-PLA1 alpha)/AH/ARWH2/LAH2/LPDLR/PLA1B/mPA-PLA1/LPDLR/MPAPL
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml |
Human Lipase H (LIPH) ELISA Kit |
20-abx152203 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Lipase H (LIPH) ELISA Kit |
abx252700-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Lipase H (LIPH)ELISA kit |
201-12-2534 |
SunredBio |
96 tests |
EUR 440 |
- This Lipase H ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Lipase H (LIPH) ELISA Kit |
SEE175Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase H (LIPH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase H (LIPH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Lipase H (LIPH) ELISA Kit |
SEE175Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase H (LIPH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase H (LIPH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Lipase H (LIPH) ELISA Kit |
SEE175Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase H (LIPH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase H (LIPH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Lipase H (LIPH) ELISA Kit |
SEE175Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase H (LIPH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase H (LIPH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Lipase H (LIPH) ELISA Kit |
4-SEE175Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Lipase H elisa. Alternative names of the recognized antigen: LPDLR
- MPAPLA1
- PLA1B
- mPA-PLA1
- LPD lipase-related protein
- Phospholipase A1 member B
- Membrane-associated phosphatidic acid-selective phospholipase A1-alpha
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lipase H (LIPH) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Monkey Lipase H (LIPH) ELISA Kit |
abx359737-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Lipase H (LIPH) ELISA Kit |
abx361407-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Lipase H (LIPH) ELISA Kit |
abx362493-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Lipase H (LIPH) ELISA Kit |
abx356437-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Lipase H (LIPH) Antibody |
20-abx113522 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lipase H (LIPH) Antibody |
abx037008-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Lipase H (LIPH) Antibody |
20-abx173356 |
Abbexa |
|
|
|
Lipase H (LIPH) Antibody |
20-abx177358 |
Abbexa |
|
|
|
Lipase H (LIPH) Antibody |
20-abx177359 |
Abbexa |
|
|
|
Lipase H (LIPH) Antibody |
20-abx334195 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lipase H (LIPH) Antibody |
abx234795-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
ELISA kit for Human LIPH (Lipase H) |
ELK4100 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipase H (LIPH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipase H (LIPH). N
- Show more
|
Description: A sandwich ELISA kit for detection of Lipase H from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Lipase member H(LIPH) ELISA kit |
CSB-EL012978HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Lipase member H (LIPH) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Lipase member H(LIPH) ELISA kit |
1-CSB-EL012978HU |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Lipase member H(LIPH) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
ELISA kit for Human LIPH (Lipase H) |
E-EL-H0433 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's LIPH ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human LIPH. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human LIPH (Lipase H) in samples from Serum, Plasma, Cell supernatant |
Human Lipase H (LIPH) CLIA Kit |
abx195074-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Lipase H (LIPH) CLIA Kit |
20-abx494527 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Lipase H (LIPH) Protein |
20-abx654190 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Guinea pig Lipase H (LIPH) ELISA Kit |
abx357624-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Lipase member H(LIPH) ELISA kit |
CSB-EL012978MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Lipase member H (LIPH) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Lipase member H(LIPH) ELISA kit |
1-CSB-EL012978MO |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Lipase member H(LIPH) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
ELISA kit for Human Lipase member H (LIPH) |
KTE61808-48T |
Abbkine |
48T |
EUR 332 |
- Lipase member H is a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation,
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Lipase member H (LIPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Lipase member H (LIPH) |
KTE61808-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Lipase member H is a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation,
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Lipase member H (LIPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Lipase member H (LIPH) |
KTE61808-96T |
Abbkine |
96T |
EUR 539 |
- Lipase member H is a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation,
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Lipase member H (LIPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Lipase H (LIPH) Antibody (HRP) |
20-abx336384 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lipase H (LIPH) Antibody (FITC) |
20-abx336385 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lipase H (LIPH) Antibody (Biotin) |
20-abx336386 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CLIA kit for Human LIPH (Lipase H) |
E-CL-H0353 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's LIPH CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human LIPH . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human LIPH (Lipase H) in samples from Serum, Plasma, Cell supernatant |
Human Lipase ELISA Kit |
CN-04596H1 |
ChemNorm |
96T |
EUR 442 |
Human Lipase ELISA Kit |
CN-04596H2 |
ChemNorm |
48T |
EUR 293 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
LIPH siRNA |
20-abx902996 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LIPH siRNA |
20-abx922628 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LIPH siRNA |
20-abx922629 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LIPH Antibody |
39893-100ul |
SAB |
100ul |
EUR 390 |
LIPH antibody |
70R-18284 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal LIPH antibody |
LIPH antibody |
70R-10356 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal LIPH antibody |
LIPH Antibody |
1-CSB-PA848833LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LIPH. Recognizes LIPH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
LIPH Antibody |
1-CSB-PA012978GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against LIPH. Recognizes LIPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
anti-LIPH |
YF-PA22685 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to LIPH |
Human Triglyceride Lipase ELISA kit |
E01T0559-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Triglyceride Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Triglyceride Lipase ELISA kit |
E01T0559-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Triglyceride Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Triglyceride Lipase ELISA kit |
E01T0559-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Triglyceride Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Endothelial lipase ELISA kit |
E01E0137-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Endothelial lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Endothelial lipase ELISA kit |
E01E0137-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Endothelial lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Endothelial lipase ELISA kit |
E01E0137-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Endothelial lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lipoprotein Lipase ELISA kit |
E01L0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Lipoprotein Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lipoprotein Lipase ELISA kit |
E01L0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Lipoprotein Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lipoprotein Lipase ELISA kit |
E01L0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Lipoprotein Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lipase, LPS ELISA kit |
E01L0312-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Lipase, LPS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lipase, LPS ELISA kit |
E01L0312-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Lipase, LPS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lipase, LPS ELISA kit |
E01L0312-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Lipase, LPS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hepatic lipase ELISA kit |
E01H0253-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hepatic lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hepatic lipase ELISA kit |
E01H0253-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hepatic lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hepatic lipase ELISA kit |
E01H0253-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hepatic lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pancreatic Lipase ELISA kit |
E01P0674-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pancreatic Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pancreatic Lipase ELISA kit |
E01P0674-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pancreatic Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pancreatic Lipase ELISA kit |
E01P0674-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pancreatic Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
QuickDetect? Lipase (Human) ELISA Kit |
E4707-100 |
Biovision |
|
EUR 588 |
Human pancreatic lipase ELISA Kit |
DEIA1968 |
Creative Diagnostics |
96T |
EUR 627 |
Description: This CD Human pancreatic lipase (PL) ELISA Kit is a 1.5 hour solid-phase ELISA designed for the quantitative determination of Human PL. This ELISA kit for research use only, not for therapeutic or diagnostic applications! |
Human LIPH shRNA Plasmid |
20-abx966263 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LIPH Recombinant Protein (Human) |
RP017848 |
ABM |
100 ug |
Ask for price |
anti- LIPH antibody |
FNab04795 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: lipase, member H
- Uniprot ID: Q8WWY8
- Gene ID: 200879
- Research Area: Metabolism
|
Description: Antibody raised against LIPH |
LIPH Rabbit pAb |
A15215-100ul |
Abclonal |
100 ul |
EUR 308 |
LIPH Rabbit pAb |
A15215-200ul |
Abclonal |
200 ul |
EUR 459 |
LIPH Rabbit pAb |
A15215-20ul |
Abclonal |
20 ul |
EUR 183 |
LIPH Rabbit pAb |
A15215-50ul |
Abclonal |
50 ul |
EUR 223 |
LIPH Polyclonal Antibody |
A70127 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
LIPH Blocking Peptide |
33R-10361 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIPH antibody, catalog no. 70R-10356 |
LIPH Polyclonal Antibody |
28874-100ul |
SAB |
100ul |
EUR 252 |
LIPH Polyclonal Antibody |
28874-50ul |
SAB |
50ul |
EUR 187 |
LIPH cloning plasmid |
CSB-CL848833HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1356
- Sequence: atgttgagattctacttattcatcagtttgttgtgcttgtcaagatcagacgcagaagaaacatgtccttcattcaccaggctgagctttcacagtgcagtggttggtacgggactaaatgtgaggctgatgctctacacaaggaaaaacctgacctgcgcacaaaccatcaact
- Show more
|
Description: A cloning plasmid for the LIPH gene. |
Anti-LIPH antibody |
STJ117409 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. |
Human Lipase, Pancreatic (PNLIP) ELISA Kit |
abx516998-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Lipase, Gastric (LIPF) ELISA Kit |
abx571303-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Lipase, Endothelial (LIPG) ELISA Kit |
abx576267-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Hepatic Lipase (LIPC) ELISA Kit |
abx576302-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human LIPH(Lipase H) ELISA Kit