Human LIPH(Lipase H) ELISA Kit

Human LIPH(Lipase H) ELISA Kit

Human Lipase H (LIPH) ELISA Kit

RD-LIPH-Hu-96Tests 96 Tests
EUR 723

Human Lipase H (LIPH)ELISA kit

201-12-2534 96 tests
EUR 440
  • This Lipase H ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Lipase H (LIPH) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Lipase H (LIPH) ELISA Kit

abx252700-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human LIPH(Lipase H) ELISA Kit

EH3297 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: Q8WWY8
  • Alias: LIPH/Phospholipase A1 member B/LPD lipase-related protein/Membrane-associated phosphatidic acid-selective phospholipase A1-alpha(mPA-PLA1 alpha)/AH/ARWH2/LAH2/LPDLR/PLA1B/mPA-PLA1/LPDLR/MPAPL
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Lipase H(LIPH)ELISA Kit

QY-E00247 96T
EUR 361

Human Lipase H (LIPH) ELISA Kit

SEE175Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase H (LIPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase H (LIPH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Lipase H (LIPH) ELISA Kit

SEE175Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase H (LIPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase H (LIPH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Lipase H (LIPH) ELISA Kit

SEE175Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase H (LIPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase H (LIPH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Lipase H (LIPH) ELISA Kit

SEE175Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipase H (LIPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipase H (LIPH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Lipase H (LIPH) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lipase H elisa. Alternative names of the recognized antigen: LPDLR
  • PLA1B
  • mPA-PLA1
  • LPD lipase-related protein
  • Phospholipase A1 member B
  • Membrane-associated phosphatidic acid-selective phospholipase A1-alpha
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lipase H (LIPH) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Lipase H (LIPH) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lipase H (LIPH) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lipase H (LIPH) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lipase H (LIPH) Antibody

abx037008-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Lipase H (LIPH) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lipase H (LIPH) Antibody

abx234795-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Lipase H (LIPH) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monkey Lipase H (LIPH) ELISA Kit

abx359737-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Lipase H (LIPH) ELISA Kit

abx361407-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Lipase H (LIPH) ELISA Kit

abx362493-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Lipase H (LIPH) ELISA Kit

abx356437-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Lipase H(LIPH)ELISA kit

QY-E10601 96T
EUR 361

Mouse Lipase H(LIPH)ELISA kit

QY-E20919 96T
EUR 361

ELISA kit for Human LIPH (Lipase H)

E-EL-H0433 1 plate of 96 wells
EUR 534
  • Gentaur's LIPH ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human LIPH. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human LIPH (Lipase H) in samples from Serum, Plasma, Cell supernatant

Human Lipase member H(LIPH) ELISA kit

CSB-EL012978HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lipase member H (LIPH) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Lipase member H(LIPH) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lipase member H(LIPH) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Lipase member H, LIPH ELISA KIT

ELI-08621h 96 Tests
EUR 824

ELISA kit for Human LIPH (Lipase H)

ELK4100 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipase H (LIPH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipase H (LIPH). N
  • Show more
Description: A sandwich ELISA kit for detection of Lipase H from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Lipase H (LIPH) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Lipase H (LIPH) CLIA Kit

abx195074-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Lipase H (LIPH) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Lipase member H(LIPH) ELISA kit

CSB-EL012978MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lipase member H (LIPH) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Lipase member H(LIPH) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lipase member H(LIPH) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit Lipase member H, LIPH ELISA KIT

ELI-20173Ra 96 Tests
EUR 928

Mouse Lipase member H, Liph ELISA KIT

ELI-22867m 96 Tests
EUR 865

Guinea pig Lipase H (LIPH) ELISA Kit

abx357624-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Lipase H (LIPH) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lipase H (LIPH) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lipase H (LIPH) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human Lipase member H (LIPH)

KTE61808-48T 48T
EUR 332
  • Lipase member H is a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation,
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lipase member H (LIPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Lipase member H (LIPH)

KTE61808-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Lipase member H is a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation,
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lipase member H (LIPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Lipase member H (LIPH)

KTE61808-96T 96T
EUR 539
  • Lipase member H is a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation,
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lipase member H (LIPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human LIPH (Lipase H)

E-CL-H0353 1 plate of 96 wells
EUR 584
  • Gentaur's LIPH CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human LIPH . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human LIPH (Lipase H) in samples from Serum, Plasma, Cell supernatant

Liph/ Rat Liph ELISA Kit

ELI-12647r 96 Tests
EUR 886


EF006953 96 Tests
EUR 689

LIPH ELISA Kit (Human) (OKCD01809)

OKCD01809 96 Wells
EUR 831
Description: Description of target: Hydrolyzes specifically phosphatidic acid (PA) to produce 2-acyl lysophosphatidic acid (LPA; a potent bioactive lipid mediator) and fatty acid. Does not hydrolyze other phospholipids, like phosphatidylserine (PS), phosphatidylcholine (PC) and phosphatidylethanolamine (PE) or triacylglycerol (TG).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.68 ng/mL

LIPH ELISA Kit (Human) (OKCA02118)

OKCA02118 96 Wells
EUR 833
Description: Description of target: Hydrolyzes specifically phosphatidic acid (PA) to produce 2-acyl lysophosphatidic acid (LPA; a potent bioactive lipid mediator) and fatty acid. Does not hydrolyze other phospholipids, like phosphatidylserine (PS), phosphatidylcholine (PC) and phosphatidylethanolamine (PE) or triacylglycerol (TG).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

LIPH ELISA Kit (Mouse) (OKCA00904)

OKCA00904 96 Wells
EUR 833
Description: Description of target: Hydrolyzes specifically phosphatidic acid (PA) to produce lysophosphatidic acid (LPA).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Human Lipase ELISA Kit

CN-04596H1 96T
EUR 442

Human Lipase ELISA Kit

CN-04596H2 48T
EUR 293

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

LIPH antibody

70R-18284 50 ul
EUR 435
Description: Rabbit polyclonal LIPH antibody

LIPH antibody

70R-10356 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LIPH antibody

LIPH Antibody

39893-100ul 100ul
EUR 390

LIPH Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIPH. Recognizes LIPH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

LIPH Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LIPH. Recognizes LIPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA22685 50 ug
EUR 363
Description: Mouse polyclonal to LIPH

Human pancreatic lipase ELISA Kit

DEIA1968 96T
EUR 627
Description: This CD Human pancreatic lipase (PL) ELISA Kit is a 1.5 hour solid-phase ELISA designed for the quantitative determination of Human PL. This ELISA kit for research use only, not for therapeutic or diagnostic applications!

Human Lipase, LPS ELISA kit

E01L0312-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipase, LPS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipase, LPS ELISA kit

E01L0312-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipase, LPS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipase, LPS ELISA kit

E01L0312-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipase, LPS in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelial lipase ELISA kit

E01E0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Endothelial lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelial lipase ELISA kit

E01E0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Endothelial lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelial lipase ELISA kit

E01E0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Endothelial lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Triglyceride Lipase ELISA kit

E01T0559-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Triglyceride Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Triglyceride Lipase ELISA kit

E01T0559-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Triglyceride Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Triglyceride Lipase ELISA kit

E01T0559-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Triglyceride Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hepatic lipase ELISA kit

E01H0253-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hepatic lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hepatic lipase ELISA kit

E01H0253-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hepatic lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hepatic lipase ELISA kit

E01H0253-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hepatic lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipoprotein Lipase ELISA kit

E01L0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Lipoprotein Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipoprotein Lipase ELISA kit

E01L0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Lipoprotein Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipoprotein Lipase ELISA kit

E01L0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Lipoprotein Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pancreatic Lipase ELISA kit

E01P0674-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Pancreatic Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pancreatic Lipase ELISA kit

E01P0674-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Pancreatic Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pancreatic Lipase ELISA kit

E01P0674-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Pancreatic Lipase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelial lipase ELISA Kit

ELA-E0469h 96 Tests
EUR 824

QuickDetect? Lipase (Human) ELISA Kit

EUR 588

Human LIPH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LIPH Recombinant Protein (Human)

RP017848 100 ug Ask for price

LIPH Polyclonal Antibody

28874-100ul 100ul
EUR 252

LIPH Polyclonal Antibody

28874-50ul 50ul
EUR 187

LIPH Blocking Peptide

33R-10361 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIPH antibody, catalog no. 70R-10356

LIPH cloning plasmid

CSB-CL848833HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atgttgagattctacttattcatcagtttgttgtgcttgtcaagatcagacgcagaagaaacatgtccttcattcaccaggctgagctttcacagtgcagtggttggtacgggactaaatgtgaggctgatgctctacacaaggaaaaacctgacctgcgcacaaaccatcaact
  • Show more
Description: A cloning plasmid for the LIPH gene.

LIPH Polyclonal Antibody

A70127 100 ?g
EUR 628.55
Description: reagents widely cited

LIPH Rabbit pAb

A15215-100ul 100 ul
EUR 308

LIPH Rabbit pAb

A15215-200ul 200 ul
EUR 459

LIPH Rabbit pAb

A15215-20ul 20 ul
EUR 183

LIPH Rabbit pAb

A15215-50ul 50 ul
EUR 223

anti- LIPH antibody

FNab04795 100µg
EUR 505.25
  • Immunogen: lipase, member H
  • Uniprot ID: Q8WWY8
  • Gene ID: 200879
  • Research Area: Metabolism
Description: Antibody raised against LIPH

Anti-LIPH antibody

PAab04795 100 ug
EUR 355

Anti-LIPH antibody

STJ117409 100 µl
EUR 277
Description: This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility.

Human Pancreatic Lipase,PL ELISA Kit

201-12-0717 96 tests
EUR 440
  • This Pancreatic Lipase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human LIPH(Lipase H) ELISA Kit