Human ITLN2(Intelectin 2) ELISA Kit
Human Intelectin 2 (ITLN2) ELISA Kit |
RD-ITLN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Intelectin 2 (ITLN2) ELISA Kit |
RD-ITLN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Intelectin 2 (ITLN2) ELISA Kit |
RDR-ITLN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Intelectin 2 (ITLN2) ELISA Kit |
RDR-ITLN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human ITLN2(Intelectin 2) ELISA Kit |
EH3280 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 6.25-400 ng/ml
- Uniprot ID: Q8WWU7
- Alias: ITLN2/Endothelial lectin HL-2/HL-2/Intelectin-b/Itln1b/ITLN2/Itlnb/HL-2/intelectin 2/UNQ2789/PRO7179
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 3.75 ng/ml |
Human Intelectin 2 (ITLN2) ELISA Kit |
20-abx151998 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Intelectin 2 (ITLN2) ELISA Kit |
abx252683-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Intelectin 2 (ITLN2)ELISA Kit |
201-12-2755 |
SunredBio |
96 tests |
EUR 440 |
- This Intelectin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Intelectin 2 (ITLN2) ELISA Kit |
SEH773Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids. |
Human Intelectin 2 (ITLN2) ELISA Kit |
SEH773Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids. |
Human Intelectin 2 (ITLN2) ELISA Kit |
SEH773Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids. |
Human Intelectin 2 (ITLN2) ELISA Kit |
SEH773Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids. |
Human Intelectin 2 (ITLN2) ELISA Kit |
4-SEH773Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Intelectin 2 elisa. Alternative names of the recognized antigen: HL-2
- Endothelial lectin HL-2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 2 (ITLN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Intelectin 2 (ITLN2) Antibody |
abx037210-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Intelectin 2 (ITLN2) Antibody |
abx027537-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Intelectin 2 (ITLN2) Antibody |
abx027537-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Intelectin 2 (ITLN2) Antibody |
20-abx172969 |
Abbexa |
|
|
|
Intelectin 2 (ITLN2) Antibody |
20-abx177020 |
Abbexa |
|
|
|
ELISA kit for Human ITLN2 (Intelectin 2) |
E-EL-H5562 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ITLN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN2. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN2 (Intelectin 2) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human ITLN2 (Intelectin 2) |
ELK3892 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 2 (ITLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 2
- Show more
|
Description: A sandwich ELISA kit for detection of Intelectin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Intelectin 2 (ITLN2) Protein |
20-abx653899 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Intelectin 2 (ITLN2) CLIA Kit |
20-abx495538 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
ITLN2 siRNA |
20-abx920956 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ITLN2 antibody |
70R-4496 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ITLN2 antibody raised against the middle region of ITLN2 |
ITLN2 Antibody |
39630-100ul |
SAB |
100ul |
EUR 390 |
ITLN2 Antibody |
42927-100ul |
SAB |
100ul |
EUR 252 |
ELISA kit for Human Intelectin-1 |
EK2456 |
SAB |
96 tests |
EUR 452 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Intelectin-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human ITLN1/ Intelectin-1 ELISA Kit |
E1354Hu |
Sunlong |
1 Kit |
EUR 537 |
Human ITLN1(Intelectin-1 ) ELISA Kit |
EH0564 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78.125-5000 pg/ml
- Uniprot ID: Q8WWA0
- Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor/omentin
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml |
Human Intelectin 1 (ITLN1) ELISA Kit |
20-abx151997 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Intelectin 1 (ITLN1) ELISA Kit |
abx253532-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Intelectin 1 (ITLN1)ELISA Kit |
201-12-2754 |
SunredBio |
96 tests |
EUR 440 |
- This Intelectin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Intelectin 1 (ITLN1) ELISA Kit |
DLR-ITLN1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Intelectin 1 (ITLN1) ELISA Kit |
DLR-ITLN1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Intelectin 1 (ITLN1) ELISA Kit |
SEA933Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Intelectin 1 (ITLN1) ELISA Kit |
SEA933Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Intelectin 1 (ITLN1) ELISA Kit |
SEA933Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Intelectin 1 (ITLN1) ELISA Kit |
SEA933Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Intelectin 1 (ITLN1) ELISA Kit |
4-SEA933Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
- INTL
- ITLN
- LFR
- HIntL
- Omentin
- Intelectin 1, Galactofuranose Binding
- Intestinal Lactoferrin Receptor
- Endothelial lectin HL-1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 1 (ITLN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Intelectin 1 ELISA Kit (ITLN1) |
RK01714 |
Abclonal |
96 Tests |
EUR 521 |
Human Intelectin 1 (ITLN1) ELISA Kit |
RD-ITLN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Intelectin 1 (ITLN1) ELISA Kit |
RD-ITLN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Intelectin 1 (ITLN1) ELISA Kit |
RDR-ITLN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Intelectin 1 (ITLN1) ELISA Kit |
RDR-ITLN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human ITLN2 shRNA Plasmid |
20-abx965352 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ITLN2 Recombinant Protein (Human) |
RP040183 |
ABM |
100 ug |
Ask for price |
ITLN2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1106803 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Intelectin 1/Omentin (ITLN1) ELISA Kit |
abx574465-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Omentin/intelectin-1 PicoKine ELISA Kit |
EK1849 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Omentin/intelectin-1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate). |
ELISA kit for Human ITLN1 (Intelectin 1) |
ELK2003 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
- Show more
|
Description: A sandwich ELISA kit for detection of Intelectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Intelectin 1/Omentin (ITLN1) ELISA Kit |
abx055557-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
ITLN2 Conjugated Antibody |
C42927 |
SAB |
100ul |
EUR 397 |
ITLN2 Blocking Peptide |
33R-9353 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN2 antibody, catalog no. 70R-4496 |
ITLN2 cloning plasmid |
CSB-CL837867HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 975
- Sequence: atgctgtccatgctgaggacaatgaccagactctgcttcctgttattcttctctgtggccaccagtgggtgcagtgcagcagcctcttctcttgagatgctctcgagggaattcgaaacctgtgccttctccttttcttccctgcctagaagctgcaaagaaatcaaggaacgctg
- Show more
|
Description: A cloning plasmid for the ITLN2 gene. |
Mouse Intelectin 1a (ITLN1) ELISA Kit |
abx575109-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Intelectin 1 (ITLN1) ELISA Kit |
20-abx155707 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Intelectin 1 (ITLN1) ELISA Kit |
20-abx154225 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Intelectin 1 (ITLN1) ELISA Kit |
DLR-ITLN1-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids. |
Mouse Intelectin 1 (ITLN1) ELISA Kit |
DLR-ITLN1-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids. |
Rat Intelectin 1 (ITLN1) ELISA Kit |
DLR-ITLN1-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids. |
Rat Intelectin 1 (ITLN1) ELISA Kit |
DLR-ITLN1-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids. |
Mouse Intelectin 1 (ITLN1) ELISA Kit |
SEA933Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids. |
Mouse Intelectin 1 (ITLN1) ELISA Kit |
SEA933Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids. |
Mouse Intelectin 1 (ITLN1) ELISA Kit |
SEA933Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids. |
Mouse Intelectin 1 (ITLN1) ELISA Kit |
SEA933Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids. |
Mouse Intelectin 1 (ITLN1) ELISA Kit |
4-SEA933Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
- INTL
- ITLN
- LFR
- HIntL
- Omentin
- Intelectin 1, Galactofuranose Binding
- Intestinal Lactoferrin Receptor
- Endothelial lectin HL-1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Intelectin 1 (ITLN1) ELISA Kit |
SEA933Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids. |
Rat Intelectin 1 (ITLN1) ELISA Kit |
SEA933Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids. |
Rat Intelectin 1 (ITLN1) ELISA Kit |
SEA933Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids. |
Rat Intelectin 1 (ITLN1) ELISA Kit |
SEA933Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids. |
Rat Intelectin 1 (ITLN1) ELISA Kit |
4-SEA933Ra |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
- INTL
- ITLN
- LFR
- HIntL
- Omentin
- Intelectin 1, Galactofuranose Binding
- Intestinal Lactoferrin Receptor
- Endothelial lectin HL-1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Intelectin 1 ELISA Kit (ITLN1) |
RK02963 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Intelectin 1 (ITLN1) ELISA Kit |
RD-ITLN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Intelectin 1 (ITLN1) ELISA Kit |
RD-ITLN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat Intelectin 1 (ITLN1) ELISA Kit |
RD-ITLN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Intelectin 1 (ITLN1) ELISA Kit |
RD-ITLN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Intelectin 1 (ITLN1) ELISA Kit |
RDR-ITLN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Intelectin 1 (ITLN1) ELISA Kit |
RDR-ITLN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Intelectin 1 (ITLN1) ELISA Kit |
RDR-ITLN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Intelectin 1 (ITLN1) ELISA Kit |
RDR-ITLN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
ITLN2 ORF Vector (Human) (pORF) |
ORF013395 |
ABM |
1.0 ug DNA |
EUR 354 |
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
ELISA kit for Human ITLN1 (Intelectin 1/Omentin) |
E-EL-H2028 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant |
Human Intelectin 1 (ITLN1) CLIA Kit |
20-abx492234 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Polyclonal ITLN2 Antibody (Center) |
APR11252G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ITLN2 (Center). This antibody is tested and proven to work in the following applications: |
Pig Intelectin 1/Omentin (ITLN1) ELISA Kit |
abx361255-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Intelectin 1/Omentin (ITLN1) ELISA Kit |
abx362579-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rat Intelectin 1/Omentin (ITLN1) ELISA Kit |
abx576145-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse ITLN1 (Intelectin 1) |
ELK2004 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
- Show more
|
Description: A sandwich ELISA kit for detection of Intelectin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat ITLN1 (Intelectin 1) |
ELK2005 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
- Show more
|
Description: A sandwich ELISA kit for detection of Intelectin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat ITLN1(Intelectin 1/Omentin) ELISA Kit |
ER1117 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml |
Mouse ITLN1(Intelectin 1/Omentin) ELISA Kit |
EM1180 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: O88310
- Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml |
Chicken Intelectin 1/Omentin (ITLN1) ELISA Kit |
abx356771-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Intelectin 1/Omentin (ITLN1) ELISA Kit |
abx359483-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rat Intelectin 1/Omentin (ITLN1) ELISA Kit |
abx255780-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Mouse Intelectin 1/Omentin (ITLN1) ELISA Kit |
abx254237-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse Intelectin 1 (ITLN1) |
KTE71460-48T |
Abbkine |
48T |
EUR 332 |
- Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Intelectin 1 (ITLN1) |
KTE71460-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Intelectin 1 (ITLN1) |
KTE71460-96T |
Abbkine |
96T |
EUR 539 |
- Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ITLN1 ELISA Kit| Rat Intelectin 1/Omentin ELISA Kit |
EF017857 |
Lifescience Market |
96 Tests |
EUR 689 |
ITLN1 ELISA Kit| Mouse Intelectin 1/Omentin ELISA Kit |
EF013735 |
Lifescience Market |
96 Tests |
EUR 689 |
ITLN2 sgRNA CRISPR Lentivector set (Human) |
K1106801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Intelectin 1/Omentin (ITLN1) CLIA Kit |
abx195758-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Intelectin 1 (ITLN1) Protein |
20-abx067298 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse ITLN1 (Intelectin 1/Omentin) |
E-EL-M0857 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant |
Guinea pig Intelectin 1/Omentin (ITLN1) ELISA Kit |
abx357571-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat ITLN1 (Intelectin 1/Omentin) |
E-EL-R0689 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
ITLN2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1106802 |
ABM |
1.0 ug DNA |
EUR 154 |
ITLN2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1106804 |
ABM |
1.0 ug DNA |
EUR 154 |
ITLN2 Protein Vector (Human) (pPB-C-His) |
PV053577 |
ABM |
500 ng |
EUR 481 |
ITLN2 Protein Vector (Human) (pPB-N-His) |
PV053578 |
ABM |
500 ng |
EUR 481 |
ITLN2 Protein Vector (Human) (pPM-C-HA) |
PV053579 |
ABM |
500 ng |
EUR 481 |
ITLN2 Protein Vector (Human) (pPM-C-His) |
PV053580 |
ABM |
500 ng |
EUR 481 |
Mouse Intelectin 1 (ITLN1) CLIA Kit |
20-abx492235 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Intelectin 1 (ITLN1) CLIA Kit |
20-abx492236 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
CLIA kit for Human ITLN1 (Intelectin 1/Omentin) |
E-CL-H1228 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant |
Intelectin 1 (ITLN1) Antibody |
20-abx101091 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Intelectin 1 (ITLN1) Antibody |
20-abx101092 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Intelectin 1 (ITLN1) Antibody |
20-abx101093 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Intelectin 1 (ITLN1) Antibody |
20-abx172967 |
Abbexa |
|
|
|
Intelectin 1 (ITLN1) Antibody |
20-abx172968 |
Abbexa |
|
|
|
Intelectin 1 (ITLN1) Antibody |
20-abx177019 |
Abbexa |
|
|
|
Intelectin 1 (ITLN1) Antibody |
20-abx212528 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Intelectin 1 (ITLN1) |
4-RPA933Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8WWA0
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.4kDa
- Isoelectric Point: 7.2
|
Description: Recombinant Human Intelectin 1 expressed in: E.coli |
Recombinant Intelectin 1 (ITLN1) |
4-RPA933Mu01 |
Cloud-Clone |
-
EUR 492.45
-
EUR 235.00
-
EUR 1571.68
-
EUR 590.56
-
EUR 1081.12
-
EUR 392.00
-
EUR 3779.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O88310
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.7kDa
- Isoelectric Point: 8.8
|
Description: Recombinant Mouse Intelectin 1 expressed in: E.coli |
Recombinant Intelectin 1 (ITLN1) |
4-RPA933Ra01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q499T8
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Intelectin 1 expressed in: E.coli |
ITLN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K1106807 |
ABM |
1.0 ug DNA |
EUR 167 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human Fibrinogen (FBG) AssayMax ELISA Kit |
EF1040-2 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse Intelectin 1/Omentin (ITLN1) CLIA Kit |
abx195759-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rat Intelectin 1/Omentin (ITLN1) CLIA Kit |
abx195760-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Dr. P Kit-Solution 2 |
K2021010-2 |
Biochain |
6 ml |
EUR 120 |
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation. |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
Mouse Intelectin 1 (ITLN1) Protein |
20-abx067296 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Intelectin 1 (ITLN1) Protein |
20-abx067297 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Intelectin 1/Omentin (ITLN1) Antibody |
20-abx113197 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Intelectin 1/Omentin (ITLN1) Antibody |
20-abx137227 |
Abbexa |
-
EUR 704.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Intelectin 1/Omentin (ITLN1) Antibody |
abx036572-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Intelectin 1/Omentin (ITLN1) Antibody |
20-abx005461 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Intelectin 1/Omentin (ITLN1) Antibody |
abx234415-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Intelectin 1 (ITLN1) Antibody (Biotin) |
20-abx272759 |
Abbexa |
-
EUR 425.00
-
EUR 230.00
-
EUR 1219.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Intelectin 1 (ITLN1) Antibody (Biotin) |
20-abx273225 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Intelectin 1/Omentin (ITLN1) Antibody |
20-abx225255 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse) |
4-PAA933Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Cys31~Gly253)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1) |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
IL-2 Interleukin-2 Human Recombinant Protein, His Tag |
PROTP60568-2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_ |
Recombinant Human BD-2 Protein |
PROTO15263-2 |
BosterBio |
20ug |
EUR 317 |
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues. |
Recombinant Human Relaxin-2 Protein |
PROTP04090-2 |
BosterBio |
25ug |
EUR 317 |
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain. |
Recombinant Human PAI-2 Protein |
PROTP05120-2 |
BosterBio |
10ug |
EUR 317 |
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein. |
Recombinant Human MMP-2 Protein |
PROTP08253-2 |
BosterBio |
10ug |
EUR 317 |
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids). |
Recombinant Human TFF-2 Protein |
PROTQ03403-2 |
BosterBio |
20ug |
EUR 317 |
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds. |
Human Factor X (Factor 10) AssayMax ELISA Kit |
EF1010-2 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5101-2 |
AssayPro |
96 Well Plate |
EUR 417 |
ITLN2 3'UTR Luciferase Stable Cell Line |
TU011353 |
ABM |
1.0 ml |
EUR 1394 |
ITLN2 3'UTR GFP Stable Cell Line |
TU061353 |
ABM |
1.0 ml |
EUR 1394 |
CLIA kit for Mouse ITLN1 (Intelectin 1/Omentin) |
E-CL-M0525 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Mouse ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant |
CLIA kit for Rat ITLN1 (Intelectin 1/Omentin) |
E-CL-R0491 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Rat ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant |
BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer |
PROTP12643-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques. |
Human Apolipoprotein C-I (Apo C1) AssayMax ELISA Kit |
EA8011-2 |
AssayPro |
96 Well Plate |
EUR 417 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit |
DLR-LAB7-2-Hu-48T |
DL Develop |
48T |
EUR 425 |
- Should the Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit |
DLR-LAB7-2-Hu-96T |
DL Develop |
96T |
EUR 548 |
- Should the Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit |
RD-LAB7-2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 418 |
Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit |
RD-LAB7-2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 575 |
Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit |
RDR-LAB7-2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 436 |
Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit |
RDR-LAB7-2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 601 |
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
ErbB2 ErbB-2 Human Recombinant Protein |
PROTP04626-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: ErbB-2 Human Recombinant is a 43.4 kDa protein containing 397 amino acid residues of the human Herstatin, and an extra Methionine at N-Terminal (underlined), produced in E.coli. |
Aflatoxin Total ELISA Kit |
DEIA051-2 |
Creative Diagnostics |
96T |
EUR 741 |
Description: This kit can be used for qualitative and quantitative analysis of aflatoxin total in edible oil, peanut, cereal etc. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), APC |
4-PAA933Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Cys31~Gly253)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAA933Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Cys31~Gly253)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with Biotin. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAA933Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Cys31~Gly253)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with Cy3. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), FITC |
4-PAA933Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Cys31~Gly253)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with FITC. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), HRP |
4-PAA933Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Cys31~Gly253)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with HRP. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), PE |
4-PAA933Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Cys31~Gly253)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with PE. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse) |
4-PAA933Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Arg28~Gly270)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1) |
Intelectin 1 (ITLN1) Polyclonal Antibody (Rat) |
4-PAA933Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Ser101~Gly292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1) |
LH (Luteinizing Hormone) ELISA test |
2 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of LH (Luteinizing Hormone) |
Human Pancreas PrimaCell 2: Pancreatic Epithelial Cells |
2-96123 |
CHI Scientific |
1 Kit |
Ask for price |
ENO2 Neurone Specific Enolase 2 Human protein |
PROTP09104-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: Human Neurone Specific Enolase produced in Human CNS having a molecular mass of 45kDa. |
ITLN2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K1106805 |
ABM |
3 x 1.0 ug |
EUR 376 |
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
Bovine Haptoglobin AssayMax ELISA Kit |
EBH2003-2 |
AssayPro |
96 Well Plate |
EUR 417 |
PLGF2 Human, Placenta Growth Factor-2 Human Recombinant Protein, CHO |
PROTP49763-2 |
BosterBio |
Regular: 25ug |
EUR 317 |
Description: PLGF2 Human Recombinant (19-170 a.a.) produced in CHO is a disulfide-linked homodimeric, glycosylated, polypeptide chain containing 152 amino acids and having a molecular mass of 33kDa.;The PLGF-2 Human Recombinant protein is purified by proprietary chromatographic techniques. |
B2M Human, Beta 2 Microglobulin Human Recombinant Protein, His Tag |
PROTP61769-2 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: B2M Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 120 amino acids (1-119 a.a.) and having a molecular mass of 14 kDa. The B2M is fused to a 21 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. |
Recombinant Human TGF-Beta 2 (insect derived) Protein |
PROTP61812-2 |
BosterBio |
10ug |
EUR 317 |
Description: The three mammalian isoforms of TGF-β, TGF-β1, β2, β3, signal through the same receptor and elicit similar biological responses. They are multifunctional cytokines that regulate cell proliferation, growth, differentiation and motility as well as synthesis and deposition of the extracellular matrix. They are involved in various physiological processes including embryogenesis, tissue remodeling and wound healing. They are secreted predominantly as latent complexes which are stored at the cell surface and in the extracellular matrix. The release of biologically active TGF-β isoform from a latent complex involves proteolytic processing of the complex and /or induction of conformational changes by proteins such as thrombospondin-1. TGF-β2 has been shown to exert suppressive effects on IL-2 dependent T-cell growth, and may also have an autocrine function in enhancing tumor growth by suppressing immuno-surveillance of tumor development. Recombinant human TGF-β2 is a 25.0 kDa protein composed of two identical 112 amino acid polypeptide chains linked by a single disulfide bond. * Manufactured using (BTI-Tn-5B1-4) cells under license from the Boyce Thompson Institute for Plant Research, Inc. |
RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9 |
PROTQ99969-2 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Human TDP2 Assay Kit |
TG1005-2 |
TopoGen |
250 assays |
EUR 660 |
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
2-Propyl-β-D-glucuronide, 2 mg |
0904-2 |
AthenaES |
2 mg |
EUR 162 |
PrecisionX Multiplex gRNA Cloning Kit |
CAS9-GRNA-KIT |
SBI |
10 rxn |
EUR 445 |
|
AHSG Alpha-2-HS-Glycoprotein Human Recombinant Protein HEK |
PROTP02765-2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: AHSG Human Recombinant produced by transfected human cells is a single polypeptide chain containing 357 amino acids (19-367). AHSG is fused to an 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques. |
FGF-2 Fibroblast Growth Factor-Basic Human Recombinant Protein |
PROTP09038-2 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: Fibroblast Growth Factor-2 Human Recombinant (FGF-2) produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 154 amino acids and having a molecular mass of 17.2kDa.;The FGF-b is purified by proprietary chromatographic techniques. |
TIMP2 Tissue Inhibitor of Metalloprotease 2 Human Recombinant Protein |
PROTP16035-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: TIMP2 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 194 amino acids and having a molecular mass of 21.8kDa.  |
Custom Anti-Peptide antibodies, 2 peptides (upto 20-aa; synthesis, 2 conjugation, 2 rabbits, 2 ELISA) |
ABPEP-20-2 |
Alpha Diagnostics |
1 |
EUR 2356 |
Recombinant Human Omentin/Intelectin-1/ITLN-1 (N-6His) |
CH39-10ug |
Novoprotein |
10ug |
EUR 156 |
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris,100mMNaCl, 5mM GSH, 0.5mM GSSG,pH8.0 . |
Recombinant Human Omentin/Intelectin-1/ITLN-1 (N-6His) |
CH39-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris,100mMNaCl, 5mM GSH, 0.5mM GSSG,pH8.0 . |
Recombinant Human Omentin/Intelectin-1/ITLN-1 (N-6His) |
CH39-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris,100mMNaCl, 5mM GSH, 0.5mM GSSG,pH8.0 . |
Recombinant Human Omentin/Intelectin-1/ITLN-1 (N-6His) |
CH39-50ug |
Novoprotein |
50ug |
EUR 369 |
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris,100mMNaCl, 5mM GSH, 0.5mM GSSG,pH8.0 . |
Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAA933Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Cys31~Gly253)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC-Cy7. |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
Custom Anti-Peptide antibodies 2 peptides (upto 20-aa, synthesis, 2 conjugation, 2 rabbits, 2 ELISA & 2 Aff. Purif.) |
ABPEP-20A-2 |
Alpha Diagnostics |
1 |
EUR 3806 |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Human TDP1 Assay Kit (Oligo) |
TG1004-2 |
TopoGen |
250 assays |
EUR 560 |
Human Topoisomerase II EMSA Kit |
TG1030-2 |
TopoGen |
25 assays |
EUR 492 |
ITLN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K1106806 |
ABM |
1.0 ug DNA |
EUR 167 |
ITLN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K1106808 |
ABM |
1.0 ug DNA |
EUR 167 |
SOX2 Human, SRY (sex determining region Y)-box 2 Human Recombinant Protein, TAT |
PROTP48431-2 |
BosterBio |
Regular: 25ug |
EUR 317 |
Description: Sox2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 330 amino acids (317 aa residues of the full length Sox2) and having a molecular mass of 36kDa.;Sox2 is fused to a 13 amino acid TAT peptide at C-terminus (GGYGRKKRRQRRR) & purified by proprietary chromatographic techniques. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), APC |
4-PAA933Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Arg28~Gly270)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAA933Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Arg28~Gly270)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with Biotin. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), Cy3 |
4-PAA933Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Arg28~Gly270)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with Cy3. |
Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), FITC |
4-PAA933Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ITLN1 (Arg28~Gly270)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with FITC. |
Human ITLN2(Intelectin 2) ELISA Kit