Human ITLN2(Intelectin 2) ELISA Kit

Human ITLN2(Intelectin 2) ELISA Kit

Human Intelectin 2 (ITLN2) ELISA Kit
RDR-ITLN2-Hu-48Tests 48 Tests
EUR 544

Human Intelectin 2 (ITLN2) ELISA Kit
RDR-ITLN2-Hu-96Tests 96 Tests
EUR 756

Human Intelectin 2 (ITLN2) ELISA Kit
RD-ITLN2-Hu-48Tests 48 Tests
EUR 521

Human Intelectin 2 (ITLN2) ELISA Kit
RD-ITLN2-Hu-96Tests 96 Tests
EUR 723

Human Intelectin 2 (ITLN2)ELISA Kit
201-12-2755 96 tests
EUR 440
  • This Intelectin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
20-abx151998
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Intelectin 2 (ITLN2) ELISA Kit
abx252683-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ITLN2(Intelectin 2) ELISA Kit
EH3280 96T
EUR 524.1
  • Detection range: 6.25-400 ng/ml
  • Uniprot ID: Q8WWU7
  • Alias: ITLN2/Endothelial lectin HL-2/HL-2/Intelectin-b/Itln1b/ITLN2/Itlnb/HL-2/intelectin 2/UNQ2789/PRO7179
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 3.75 ng/ml

Human Intelectin- 2, ITLN2 ELISA KIT
ELI-28050h 96 Tests
EUR 824

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
4-SEH773Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 2 elisa. Alternative names of the recognized antigen: HL-2
  • Endothelial lectin HL-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 2 (ITLN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Intelectin 2(ITLN2)ELISA Kit
QY-E02126 96T
EUR 361

Intelectin 2 (ITLN2) Antibody
abx027537-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody
abx027537-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody
20-abx177020
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 2 (ITLN2) Antibody
abx037210-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody
20-abx172969
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Intelectin 2 (ITLN2) Protein
20-abx653899
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Intelectin 2 (ITLN2) CLIA Kit
20-abx495538
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human ITLN2 (Intelectin 2)
E-EL-H5562 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN2 (Intelectin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ITLN2 (Intelectin 2)
ELK3892 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 2 (ITLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 2
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ITLN2 ELISA KIT|Human
EF006945 96 Tests
EUR 689

ITLN2 ELISA Kit (Human) (OKCD01969)
OKCD01969 96 Wells
EUR 831
Description: Description of target: May play a role in the defense system against pathogens.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.06 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

ITLN2 Antibody
42927-100ul 100ul
EUR 252

ITLN2 Antibody
39630-100ul 100ul
EUR 390

ITLN2 antibody
70R-4496 50 ug
EUR 467
Description: Rabbit polyclonal ITLN2 antibody raised against the middle region of ITLN2

ITLN2 siRNA
20-abx920956
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human ITLN2 shRNA Plasmid
20-abx965352
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ITLN2 Recombinant Protein (Human)
RP040183 100 ug Ask for price

Human Intelectin 1 (ITLN1)ELISA Kit
201-12-2754 96 tests
EUR 440
  • This Intelectin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Hu-48T 48T
EUR 479
  • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Hu-96T 96T
EUR 621
  • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
20-abx151997
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Intelectin 1 (ITLN1) ELISA Kit
abx253532-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Intelectin-1
EK2456 96 tests
EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Intelectin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ITLN1/ Intelectin-1 ELISA Kit
E1354Hu 1 Kit
EUR 537

Human ITLN1(Intelectin-1 ) ELISA Kit
EH0564 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: Q8WWA0
  • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor/omentin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Intelectin- 1, ITLN1 ELISA KIT
ELI-03070h 96 Tests
EUR 824

Human Intelectin 1(ITLN1)ELISA Kit
QY-E02127 96T
EUR 361

Human Intelectin 1 ELISA Kit (ITLN1)
RK01714 96 Tests
EUR 521

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
4-SEA933Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 1 (ITLN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Hu-48Tests 48 Tests
EUR 500

Human Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Hu-96Tests 96 Tests
EUR 692

Human Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Hu-48Tests 48 Tests
EUR 478

Human Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Hu-96Tests 96 Tests
EUR 662

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1106803 1.0 ug DNA
EUR 154

ITLN2 Blocking Peptide
33R-9353 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN2 antibody, catalog no. 70R-4496

ITLN2 Conjugated Antibody
C42927 100ul
EUR 397

ITLN2 cloning plasmid
CSB-CL837867HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 975
  • Sequence: atgctgtccatgctgaggacaatgaccagactctgcttcctgttattcttctctgtggccaccagtgggtgcagtgcagcagcctcttctcttgagatgctctcgagggaattcgaaacctgtgccttctccttttcttccctgcctagaagctgcaaagaaatcaaggaacgctg
  • Show more
Description: A cloning plasmid for the ITLN2 gene.

Human Intelectin 1/Omentin (ITLN1) ELISA Kit
abx055557-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Omentin/intelectin-1 PicoKine ELISA Kit
EK1849 96 wells
EUR 425
Description: For quantitative detection of human Omentin/intelectin-1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

ELISA kit for Human ITLN1 (Intelectin 1)
ELK2003 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Intelectin 1/Omentin (ITLN1) ELISA Kit
abx574465-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

ITLN2 ORF Vector (Human) (pORF)
ORF013395 1.0 ug DNA
EUR 354

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Mouse Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Mu-48T 48T
EUR 489
  • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Mu-96T 96T
EUR 635
  • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Ra-48T 48T
EUR 508
  • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Ra-96T 96T
EUR 661
  • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
20-abx155707
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Intelectin 1 (ITLN1) ELISA Kit
20-abx154225
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Intelectin- 1a, Itln1 ELISA KIT
ELI-03069m 96 Tests
EUR 865

Mouse Intelectin 1a (ITLN1) ELISA Kit
abx575109-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Intelectin- 1b, Itln1b ELISA KIT
ELI-39394m 96 Tests
EUR 865

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
4-SEA933Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
4-SEA933Ra
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Mu-48Tests 48 Tests
EUR 511

Mouse Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Mu-96Tests 96 Tests
EUR 709

Rat Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Ra-48Tests 48 Tests
EUR 534

Rat Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Ra-96Tests 96 Tests
EUR 742

Mouse Intelectin 1 ELISA Kit (ITLN1)
RK02963 96 Tests
EUR 521

Mouse Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Mu-48Tests 48 Tests
EUR 489

Mouse Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Mu-96Tests 96 Tests
EUR 677

Rat Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Ra-48Tests 48 Tests
EUR 511

Rat Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Ra-96Tests 96 Tests
EUR 709

Human Intelectin 1 (ITLN1) CLIA Kit
20-abx492234
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Polyclonal ITLN2 Antibody (Center)
APR11252G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ITLN2 (Center). This antibody is tested and proven to work in the following applications:

ELISA kit for Human ITLN1 (Intelectin 1/Omentin)
E-EL-H2028 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

ITLN2 sgRNA CRISPR Lentivector set (Human)
K1106801 3 x 1.0 ug
EUR 339

Human Intelectin 1 (ITLN1) Protein
20-abx067298
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Intelectin 1/Omentin (ITLN1) ELISA Kit
abx254237-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit
abx255780-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human ITLN2(Intelectin 2) ELISA Kit