Human HPD(4-Hydroxyphenylpyruvate Dioxygenase) ELISA Kit

Human HPD(4-Hydroxyphenylpyruvate Dioxygenase) ELISA Kit

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

RD-HPD-Hu-96Tests 96 Tests
EUR 723

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

RDR-HPD-Hu-48Tests 48 Tests
EUR 544

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

RDR-HPD-Hu-96Tests 96 Tests
EUR 756

Human 4-hydroxyphenylpyruvate dioxygenase (HPD)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 4-hydroxyphenylpyruvate dioxygenase(HPD) expressed in E.coli

Human 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E01H1389-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E01H1389-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E01H1389-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 4- hydroxyphenylpyruvate dioxygenase, HPD ELISA KIT

ELI-38638h 96 Tests
EUR 824

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

SEE251Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids.

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

SEE251Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids.

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

SEE251Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids.

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

SEE251Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids.

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as 4-Hydroxyphenylpyruvate Dioxygenase elisa. Alternative names of the recognized antigen: PPD
  • 4-HPPD
  • 4HPPD
  • GLOD3
  • Glyoxalase Domain Containing 3
  • 4-hydroxyphenylpyruvic acid oxidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody

abx145589-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody

abx034014-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody

abx034014-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody

abx233993-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant 4-Hydroxyphenylpyruvate Dioxygenase (HPD)

  • EUR 474.53
  • EUR 230.00
  • EUR 1504.48
  • EUR 568.16
  • EUR 1036.32
  • EUR 380.00
  • EUR 3611.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P32754
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 48.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase expressed in: E.coli

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) Protein

abx060043-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E06H1389-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E06H1389-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E06H1389-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E02H1389-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E02H1389-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E02H1389-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E03H1389-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E03H1389-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E03H1389-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E04H1389-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E04H1389-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E04H1389-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E08H1389-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E08H1389-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E08H1389-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E07H1389-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E07H1389-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E07H1389-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine 4- hydroxyphenylpyruvate dioxygenase, HPD ELISA KIT

ELI-08367p 96 Tests
EUR 928

Mouse 4- hydroxyphenylpyruvate dioxygenase, Hpd ELISA KIT

ELI-27106m 96 Tests
EUR 865

Bovine 4- hydroxyphenylpyruvate dioxygenase, HPD ELISA KIT

ELI-27791b 96 Tests
EUR 928

Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E09H1389-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E09H1389-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E09H1389-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse 4-hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

abx388466-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

SEE251Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in Tissue homogenates, cell lysates and other biological fluids.

Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

SEE251Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in Tissue homogenates, cell lysates and other biological fluids.

Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

SEE251Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in Tissue homogenates, cell lysates and other biological fluids.

Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

SEE251Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in Tissue homogenates, cell lysates and other biological fluids.

Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as 4-Hydroxyphenylpyruvate Dioxygenase elisa. Alternative names of the recognized antigen: PPD
  • 4-HPPD
  • 4HPPD
  • GLOD3
  • Glyoxalase Domain Containing 3
  • 4-hydroxyphenylpyruvic acid oxidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human HPD (4-Hydroxyphenylpyruvate Dioxygenase)

ELK3809 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to 4-Hydroxyphenylpyruvate Dioxygenase (HPD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of 4-Hydroxyphenylpyruvate Dioxygenase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody Pair

abx117627-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hpd ELISA Kit| Mouse 4-hydroxyphenylpyruvate dioxygenase ELISA

EF014089 96 Tests
EUR 689

HPD ELISA Kit| Bovine 4-hydroxyphenylpyruvate dioxygenase ELISA

EF011066 96 Tests
EUR 689

Rat 4-Hydroxyphenylpyruvate Dioxygenase (HPD) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

HPD 4-Hydroxyphenylpyruvate Dioxygenase Human Recombinant Protein

PROTP32754 Regular: 10ug
EUR 317
Description: HPD produced in E.Coli is a single, non-glycosylated polypeptide chain containing 413 amino acids (1-393a.a.) and having a molecular mass of 47kDa.;HPD is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E05H1389-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E05H1389-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) ELISA kit

E05H1389-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 4 hydroxyphenylpyruvate dioxygenase(HPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat HPD (4-Hydroxyphenylpyruvate Dioxygenase)

ELK7426 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to 4-Hydroxyphenylpyruvate Dioxygenase (HPD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of 4-Hydroxyphenylpyruvate Dioxygenase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Wide-range 4-Hydroxyphenylpyruvate Dioxygenase ELISA Kit (HPD)

RK01582 96 Tests
EUR 521

Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

WEE251Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

WEE251Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

WEE251Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

WEE251Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in serum, plasma, tissue homogenates and other biological fluids.

Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as 4-Hydroxyphenylpyruvate Dioxygenase elisa. Alternative names of the recognized antigen: PPD
  • 4-HPPD
  • 4HPPD
  • GLOD3
  • Glyoxalase Domain Containing 3
  • 4-hydroxyphenylpyruvic acid oxidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Wide-range Human 4-Hydroxyphenylpyruvate Dioxygenase (HPD) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Hpd ELISA Kit| Rat 4-hydroxyphenylpyruvate dioxygenase ELISA Ki

EF018255 96 Tests
EUR 689

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HPD (Thr2~Met393 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD)

Human Wide-range 4-Hydroxyphenylpyruvate Dioxygenase (HPD) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HPD (Thr2~Met393 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with APC.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HPD (Thr2~Met393 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with Biotin.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HPD (Thr2~Met393 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with Cy3.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HPD (Thr2~Met393 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with FITC.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HPD (Thr2~Met393 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with HRP.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HPD (Thr2~Met393 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with PE.

4-Hydroxyphenylpyruvate Dioxygenase (HPD) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HPD (Thr2~Met393 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig 4-Hydroxyphenylpyruvate Dioxygenase (HPD). This antibody is labeled with APC-Cy7.

4-Hydroxyphenylpyruvate Dioxygenase (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase

7-02971 2µg Ask for price

Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase

7-02972 10µg Ask for price

Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase

7-02973 1mg Ask for price

4-Hydroxyphenylpyruvate Dioxygenase (4-HPPD) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

4-Hydroxyphenylpyruvate Dioxygenase (4-HPPD) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

4-hydroxyphenylpyruvate dioxygenase Polyclonal Antibody

42213-100ul 100ul
EUR 333

Hpdl ELISA Kit| Mouse 4-hydroxyphenylpyruvate dioxygenase-like

EF014090 96 Tests
EUR 689

Mouse 4-hydroxyphenylpyruvate Dioxygenase Like (HPDL) ELISA Kit

abx388467-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat 4-hydroxyphenylpyruvate Dioxygenase Like (HPDL) ELISA Kit

abx390904-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human 4-Hydroxyphenylpyruvate Dioxygenase-Like Protein (HPDL) ELISA Kit

abx387871-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

4-hydroxyphenylpyruvate dioxygenase Polyclonal Conjugated Antibody

C42213 100ul
EUR 397

Hpdl ELISA Kit| Rat 4-hydroxyphenylpyruvate dioxygenase-like pr

EF018256 96 Tests
EUR 689

4-Hydroxyphenylpyruvate Dioxygenase-Like Protein (HPDL) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

4-Hydroxyphenylpyruvate Dioxygenase-Like Protein (HPDL) Antibody

abx233994-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase/4HPPD/HPPDase (N-6His)

CE50-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 50mM NaCl, 1mM DTT, 0.1mM PMSF, pH 8.0.

Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase/4HPPD/HPPDase (N-6His)

CE50-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 50mM NaCl, 1mM DTT, 0.1mM PMSF, pH 8.0.

Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase/4HPPD/HPPDase (N-6His)

CE50-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 50mM NaCl, 1mM DTT, 0.1mM PMSF, pH 8.0.

Recombinant Human 4-Hydroxyphenylpyruvate Dioxygenase/4HPPD/HPPDase (N-6His)

CE50-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 50mM NaCl, 1mM DTT, 0.1mM PMSF, pH 8.0.

Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-100ug

QP6179-ec-100ug 100ug
EUR 408

Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-10ug

QP6179-ec-10ug 10ug
EUR 200

Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-1mg

QP6179-ec-1mg 1mg
EUR 1632

Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-200ug

QP6179-ec-200ug 200ug
EUR 634

Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-500ug

QP6179-ec-500ug 500ug
EUR 1060

Recombinant Human 4-hydroxyphenylpyruvate dioxygenase Protein, His, E.coli-50ug

QP6179-ec-50ug 50ug
EUR 263

Hpd/ Rat Hpd ELISA Kit

ELI-27792r 96 Tests
EUR 886


EF010206 96 Tests
EUR 689

HPD ELISA Kit (Human) (OKCD01234)

OKCD01234 96 Wells
EUR 831
Description: Description of target: Key enzyme in the degradation of tyrosine. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.32 ng/mL

HPD ELISA Kit (Human) (OKCD09576)

OKCD09576 96 Wells
EUR 936
Description: Description of target: The protein encoded by this gene is an enzyme in the catabolic pathway of tyrosine. The encoded protein catalyzes the conversion of 4-hydroxyphenylpyruvate to homogentisate. Defects in this gene are a cause of tyrosinemia type 3 (TYRO3) and hawkinsinuria ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 1.13ng/mL


E541-446 100ug
EUR 343

Hpd ELISA Kit (Rat) (OKCD01816)

OKCD01816 96 Wells
EUR 896
Description: Description of target: Key enzyme in the degradation of tyrosine. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.35 ng/mL

IL-4 Interleukin 4 Human Recombinant Protein, Yeast

PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Methylcytosine dioxygenase ELISA kit

E01T0868-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Methylcytosine dioxygenase ELISA kit

E01T0868-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Methylcytosine dioxygenase ELISA kit

E01T0868-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Methylcytosine dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-48Tests 48 Tests
EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-96Tests 96 Tests
EUR 662

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-48Tests 48 Tests
EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-96Tests 96 Tests
EUR 692


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HPD antibody

70R-2553 50 ug
EUR 467
Description: Rabbit polyclonal HPD antibody raised against the middle region of HPD

HPD Antibody

ABD8303 100 ug
EUR 438

HPD Antibody

ABD8336 100 ug
EUR 438

HPD antibody

38968-100ul 100ul
EUR 252

HPD Antibody

43066-100ul 100ul
EUR 252

HPD antibody

70R-17799 50 ul
EUR 435
Description: Rabbit polyclonal HPD antibody

HPD Antibody

DF8303 200ul
EUR 304
Description: HPD Antibody detects endogenous levels of total HPD.

HPD Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HPD. Recognizes HPD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HPD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPD. Recognizes HPD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

Human FibrOut 4, for brain, neural

4-21552 1 ml Ask for price

Human FibrOut 4, for brain, neural

4-21553 5 x 1 ml Ask for price

Recombinant Human PF-4 (CXCL4) Protein

PROTP02776-4 20ug
EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

Recombinant Human 4-1BB Receptor Protein

PROTQ07011-4 20ug
EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

Human HPD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HPD Recombinant Protein (Human)

RP015193 100 ug Ask for price

Human Tryptophan 2,3 dioxygenase ELISA kit

E01T0142-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophan 2,3 dioxygenase ELISA kit

E01T0142-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophan 2,3 dioxygenase ELISA kit

E01T0142-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophan 2,3 dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoleamine 2,3 Dioxygenase ELISA kit

E01I0057-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoleamine 2,3 Dioxygenase ELISA kit

E01I0057-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Indoleamine 2,3 Dioxygenase ELISA kit

E01I0057-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Indoleamine 2,3 Dioxygenase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Individual Reaction Mix 4

G065-4 200 reactions
EUR 167

HPD Conjugated Antibody

C38968 100ul
EUR 397

HPD Conjugated Antibody

C43066 100ul
EUR 397

HPD cloning plasmid

CSB-CL010698HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atgacgacttacagtgacaaaggggcaaagcctgagagaggccgattcctccacttccactctgtgaccttctgggttggcaacgccaagcaggccgcgtcattctactgcagcaagatgggctttgaacctctagcctacaggggcctggagaccggttcccgggaggtggtca
  • Show more
Description: A cloning plasmid for the HPD gene.

anti- HPD antibody

FNab03993 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: 4-hydroxyphenylpyruvate dioxygenase
  • Uniprot ID: P32754
  • Gene ID: 3242
  • Research Area: Metabolism
Description: Antibody raised against HPD

HPD Rabbit pAb

A3918-100ul 100 ul
EUR 308

HPD Rabbit pAb

A3918-200ul 200 ul
EUR 459

HPD Rabbit pAb

A3918-20ul 20 ul Ask for price

HPD Rabbit pAb

A3918-50ul 50 ul Ask for price

Human HPD(4-Hydroxyphenylpyruvate Dioxygenase) ELISA Kit