Human HMBS(Hydroxymethylbilane Synthase) ELISA Kit

Human HMBS(Hydroxymethylbilane Synthase) ELISA Kit

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit

RD-HMBS-Hu-48Tests 48 Tests
EUR 521

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit

RD-HMBS-Hu-96Tests 96 Tests
EUR 723

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hydroxymethylbilane Synthase ELISA Kit (HMBS)

RK01572 96 Tests
EUR 521

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit

SEE673Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit

SEE673Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit

SEE673Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit

SEE673Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Hydroxymethylbilane Synthase elisa. Alternative names of the recognized antigen: PBG-D
  • PBGD
  • UPS
  • Hydroxymethylbilane Synthase
  • Uroporphyrinogen I Synthase
  • Porphobilinogen deaminase
  • Pre-uroporphyrinogen synthase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hydroxymethylbilane Synthase (HMBS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Hydroxymethylbilane Synthase (HMBS) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hydroxymethylbilane Synthase (HMBS) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hydroxymethylbilane Synthase (HMBS) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Hydroxymethylbilane Synthase (HMBS)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08397
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.6kDa
  • Isoelectric Point: 6.5
Description: Recombinant Human Hydroxymethylbilane Synthase expressed in: E.coli

Human Hydroxymethylbilane Synthase (HMBS) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Hydroxymethylbilane Synthase (HMBS) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human HMBS (Hydroxymethylbilane Synthase)

ELK4111 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hydroxymethylbilane Synthase (HMBS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Hydroxymethylbilane Synthase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

HMBS Hydroxymethylbilane Synthase Human Recombinant Protein

PROTP08397 Regular: 20ug
EUR 317
Description: HMBS Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 385 amino acids (1-361) and having a molecular mass of 41.9kDa.;HMBS is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMBS (Leu85~Ser337)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS)

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMBS (Leu85~Ser337)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with APC.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMBS (Leu85~Ser337)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with Biotin.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMBS (Leu85~Ser337)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with Cy3.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMBS (Leu85~Ser337)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with FITC.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMBS (Leu85~Ser337)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with HRP.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMBS (Leu85~Ser337)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with PE.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMBS (Leu85~Ser337)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with APC-Cy7.

Hydroxymethylbilane Synthase (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Hmbs/ Rat Hmbs ELISA Kit

ELI-30905r 96 Tests
EUR 886


EF010156 96 Tests
EUR 689

HMBS ELISA Kit (Human) (OKAN06214)

OKAN06214 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.26 ng/mL

HMBS ELISA Kit (Human) (OKCD08681)

OKCD08681 96 Wells
EUR 975
Description: Description of target: HMBS is a member of the hydroxymethylbilane synthase superfamily. It is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria.This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.26ng/mL

HMBS ELISA Kit (Human) (OKEH02521)

OKEH02521 96 Wells
EUR 831
Description: Description of target: This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.327 ng/mL

Human HMBS/ Porphobilinogen deaminase ELISA Kit

E1138Hu 1 Kit
EUR 605

Human Porphobilinogen deaminase (HMBS) ELISA Kit

abx573587-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Porphobilinogen deaminase, HMBS ELISA KIT

ELI-48602h 96 Tests
EUR 824

Human HMBS Antibody

35685-05111 150 ug
EUR 261

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

HMBS antibody

70R-17754 50 ul
EUR 435
Description: Rabbit polyclonal HMBS antibody

HMBS Antibody

32430-100ul 100ul
EUR 252

HMBS Antibody

49010-100ul 100ul
EUR 333

HMBS Antibody

49010-50ul 50ul
EUR 239

HMBS Antibody

DF6611 200ul
EUR 304
Description: HMBS Antibody detects endogenous levels of total HMBS.

HMBS antibody

70R-3585 50 ug
EUR 467
Description: Rabbit polyclonal HMBS antibody raised against the middle region of HMBS

HMBS antibody

70R-3343 50 ug
EUR 467
Description: Rabbit polyclonal HMBS antibody raised against the N terminal of HMBS

HMBS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

HMBS Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

HMBS Antibody

CSB-PA010524KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

HMBS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMBS Antibody

ABD6611 100 ug
EUR 438


PVT18460 2 ug
EUR 231


YF-PA12376 50 ul
EUR 363
Description: Mouse polyclonal to HMBS


YF-PA12377 100 ug
EUR 403
Description: Rabbit polyclonal to HMBS

Mouse Hmbs/ Porphobilinogen deaminase ELISA Kit

E0677Mo 1 Kit
EUR 632

Mouse Porphobilinogen deaminase, Hmbs ELISA KIT

ELI-30904m 96 Tests
EUR 865

Bovine Porphobilinogen deaminase, HMBS ELISA KIT

ELI-43928b 96 Tests
EUR 928

Mouse Porphobilinogen deaminase (HMBS) ELISA Kit

abx555617-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Porphobilinogen deaminase (HMBS) ELISA Kit

abx555711-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Cow Porphobilinogen deaminase (HMBS) ELISA Kit

abx555776-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human HMBS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HMBS Recombinant Protein (Human)

RP014953 100 ug Ask for price

HMBS Rabbit mAb

A11701-100ul 100 ul
EUR 410

HMBS Rabbit mAb

A11701-200ul 200 ul
EUR 571

HMBS Rabbit mAb

A11701-20ul 20 ul
EUR 221

HMBS Rabbit mAb

A11701-50ul 50 ul
EUR 287

HMBS Blocking Peptide

33R-8825 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMBS antibody, catalog no. 70R-3585

HMBS Blocking Peptide

33R-6388 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMBS antibody, catalog no. 70R-3343

HMBS Blocking Peptide

DF6611-BP 1mg
EUR 195

Anti-HMBS Antibody

A01506-1 100ug/vial
EUR 294

HMBS Conjugated Antibody

C49010 100ul
EUR 397

HMBS Conjugated Antibody

C32430 100ul
EUR 397

HMBS cloning plasmid

CSB-CL010524HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1086
  • Sequence: atgtctggtaacggcaatgcggctgcaacggcggaagaaaacagcccaaagatgagagtgattcgcgtgggtacccgcaagagccagcttgctcgcatacagacggacagtgtggtggcaacattgaaagcctcgtaccctggcctgcagtttgaaatcattgctatgtccacca
  • Show more
Description: A cloning plasmid for the HMBS gene.

HMBS Rabbit pAb

A1777-100ul 100 ul
EUR 308

HMBS Rabbit pAb

A1777-200ul 200 ul
EUR 459

HMBS Rabbit pAb

A1777-20ul 20 ul
EUR 183

HMBS Rabbit pAb

A1777-50ul 50 ul
EUR 223

anti- HMBS antibody

FNab03918 100µg
EUR 505.25
  • Immunogen: hydroxymethylbilane synthase
  • Uniprot ID: P08397
  • Gene ID: 3145
  • Research Area: Metabolism
Description: Antibody raised against HMBS

Anti-HMBS antibody

PAab03918 100 ug
EUR 355

Anti-HMBS antibody

STJ24034 100 µl
EUR 277
Description: This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-HMBS (3E8)

YF-MA13480 100 ug
EUR 363
Description: Mouse monoclonal to HMBS

Anti-HMBS (2B12)

YF-MA13481 100 ug
EUR 363
Description: Mouse monoclonal to HMBS

Human HMBS Antibody (Biotin Conjugate)

35685-05121 150 ug
EUR 369

HMBS ORF Vector (Human) (pORF)

ORF004985 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Cardiolipin Synthase ELISA kit

E01C0634-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cardiolipin Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cardiolipin Synthase ELISA kit

E01C0634-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cardiolipin Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cardiolipin Synthase ELISA kit

E01C0634-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cardiolipin Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Citrate Synthase ELISA kit

E01C0830-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Citrate Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Citrate Synthase ELISA kit

E01C0830-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Citrate Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Citrate Synthase ELISA kit

E01C0830-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Citrate Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thromboxane synthase ELISA kit

E01T0553-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Thromboxane synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thromboxane synthase ELISA kit

E01T0553-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Thromboxane synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thromboxane synthase ELISA kit

E01T0553-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Thromboxane synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

HMBS protein (His tag)

80R-2177 100 ug
EUR 322
Description: Purified recombinant Human HMBS protein (His tag)

Porphobilinogen Deaminase (HMBS) Antibody

abx117159-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Porphobilinogen Deaminase (HMBS) Antibody

abx038138-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Porphobilinogen Deaminase (HMBS) Antibody

abx145984-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

HMBS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HMBS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HMBS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Porphobilinogen Deaminase (HMBS) Antibody

abx233918-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Porphobilinogen Deaminase (HMBS) Antibody

abx432804-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Porphobilinogen Deaminase (HMBS) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse HMBS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HMBS recombinant monoclonal antibody

A5880 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human HMBS for WB,ELISA

Porphobilinogen Deaminase (HMBS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human HMBS(Hydroxymethylbilane Synthase) ELISA Kit