Human gGH(Gamma-Glutamyl Hydrolase) ELISA Kit

Human gGH(Gamma-Glutamyl Hydrolase) ELISA Kit

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
RDR-gGH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
RD-gGH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
RD-gGH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human gamma Glutamyl Hydrolase (gGH) ELISA Kit
20-abx151653	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Gamma-Glutamyl Hydrolase (GGH) ELISA Kit
abx257522-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human GGH(Gamma-glutamyl hydrolase) ELISA Kit
EH4206	FN Test	96T	EUR 524.1
Detection range: 0.469-30 ng/ml Uniprot ID: Q92820
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.281 ng/ml

Human Gamma-glutamyl hydrolase(GGH) ELISA kit
CSB-EL009389HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Gamma-glutamyl hydrolase (GGH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Gamma-glutamyl hydrolase(GGH) ELISA kit
1-CSB-EL009389HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Gamma-glutamyl hydrolase(GGH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Gamma- glutamyl hydrolase, GGH ELISA KIT
ELI-47204h	Lifescience Market	96 Tests	EUR 824

Human Gamma-Glutamyl Hydrolase ELISA Kit (gGH)
RK01457	Abclonal	96 Tests	EUR 521

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
SEJ038Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
SEJ038Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
SEJ038Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
SEJ038Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
4-SEJ038Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Gamma-Glutamyl Hydrolase elisa. Alternative names of the recognized antigen: GH conjugase, folylpolygammaglutamyl hydrolase Gamma-Glu-X carboxypeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Gamma-Glutamyl Hydrolase (gGH) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Gamma-Glutamyl Hydrolase (GGH) Antibody
abx026162-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody
abx026162-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody
abx026577-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody
abx026577-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody
20-abx004184	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody
abx036630-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (gGH) Antibody
20-abx129147	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody
20-abx133717	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (gGH) Antibody
20-abx172517	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Gamma-Glutamyl Hydrolase (GGH) Antibody
20-abx014485	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody
abx330971-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody
20-abx324404	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody
20-abx300931	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody
20-abx302501	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Gamma-Glutamyl Hydrolase (gGH)
4-RPJ038Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q92820 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.3kDa Isoelectric Point: Inquire
Description: Recombinant Human Gamma-Glutamyl Hydrolase expressed in: E.coli

Human Gamma-Glutamyl Hydrolase (gGH) Protein
20-abx166621	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Bovine Gamma- glutamyl hydrolase, GGH ELISA KIT
ELI-31113b	Lifescience Market	96 Tests	EUR 928

Mouse Gamma- glutamyl hydrolase, Ggh ELISA KIT
ELI-43507m	Lifescience Market	96 Tests	EUR 865

Rat Gamma-Glutamyl Hydrolase (GGH) ELISA Kit
abx391375-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Gamma-Glutamyl Hydrolase (GGH) ELISA Kit
abx389383-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human gamma Glutamyl Hydrolase (gGH) CLIA Kit
20-abx495599	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human gGH (Gamma-Glutamyl Hydrolase)
ELK3849	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Gamma-Glutamyl Hydrolase (gGH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gam Show more
Description: A sandwich ELISA kit for detection of Gamma-Glutamyl Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-GGH/Gamma Glutamyl Hydrolase Antibody
A03161	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GGH/Gamma Glutamyl Hydrolase Antibody. Validated in WB and tested in Human, Mouse.

Gamma-Glutamyl Hydrolase (GGH) Blocking Peptide
20-abx061299	Abbexa	EUR 286.00 EUR 425.00	1 mg 5 mg
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody (HRP)
20-abx316896	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody (FITC)
20-abx316897	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody (Biotin)
20-abx316898	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human)
4-PAJ038Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: gGH (Arg25~Asp318) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH)

Ggh ELISA Kit| Rat Gamma-glutamyl hydrolase ELISA Kit
EF018731	Lifescience Market	96 Tests	EUR 689

Ggh ELISA Kit| Mouse Gamma-glutamyl hydrolase ELISA Kit
EF015016	Lifescience Market	96 Tests	EUR 689

GGH ELISA Kit| Bovine Gamma-glutamyl hydrolase ELISA Kit
EF011418	Lifescience Market	96 Tests	EUR 689

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), APC
4-PAJ038Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: gGH (Arg25~Asp318) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with APC.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), Biotinylated
4-PAJ038Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: gGH (Arg25~Asp318) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with Biotin.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), Cy3
4-PAJ038Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: gGH (Arg25~Asp318) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with Cy3.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), FITC
4-PAJ038Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: gGH (Arg25~Asp318) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with FITC.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), HRP
4-PAJ038Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: gGH (Arg25~Asp318) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with HRP.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), PE
4-PAJ038Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: gGH (Arg25~Asp318) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with PE.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), APC-Cy7
4-PAJ038Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: gGH (Arg25~Asp318) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with APC-Cy7.

gamma Glutamyl Hydrolase (Recombinant)
20-abx073267	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Gamma-glutamyl hydrolase Antibody
1-CSB-PA009389LA01GGV	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

Human Glutamyl hydrolase gamma Antibody
32914-05111	AssayPro	150 ug	EUR 261

GGH Gamma-Glutamyl HydrolaseHuman Recombinant Protein
PROTQ92820	BosterBio	Regular: 20ug	EUR 317
Description: GGH Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 315 amino acids (25-318) and having a molecular mass of 35.9kDa.;GGH is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Glycine max Gamma-glutamyl hydrolase
1-CSB-EP009389GGV	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 51.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Glycine max Gamma-glutamyl hydrolase expressed in E.coli

Gamma-glutamyl hydrolase Antibody (HRP)
20-abx300933	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gamma-glutamyl hydrolase Antibody (FITC)
20-abx300934	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gamma-glutamyl hydrolase Antibody (Biotin)
20-abx300935	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gamma-glutamyl hydrolase Antibody, HRP conjugated
1-CSB-PA009389LB01GGV	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is HRP conjugated. Tested in the following application: ELISA

Gamma-glutamyl hydrolase Antibody, FITC conjugated
1-CSB-PA009389LC01GGV	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is FITC conjugated. Tested in the following application: ELISA

Gamma-glutamyl hydrolase Antibody, Biotin conjugated
1-CSB-PA009389LD01GGV	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Glutamyl hydrolase gamma Antibody (Biotin Conjugate)
32914-05121	AssayPro	150 ug	EUR 369

Human Glutamyl hydrolase gamma AssayLite Antibody (FITC Conjugate)
32914-05141	AssayPro	150 ug	EUR 428

Human Glutamyl hydrolase gamma AssayLite Antibody (RPE Conjugate)
32914-05151	AssayPro	150 ug	EUR 428

Human Glutamyl hydrolase gamma AssayLite Antibody (APC Conjugate)
32914-05161	AssayPro	150 ug	EUR 428

Human Glutamyl hydrolase gamma AssayLite Antibody (PerCP Conjugate)
32914-05171	AssayPro	150 ug	EUR 471

Human gamma glutamyl transpeptidase,GGT ELISA Kit
201-12-1348	SunredBio	96 tests	EUR 440
This gamma glutamyl transpeptidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human gamma glutamyl transpeptidase, GGT ELISA Kit
CSB-EL009394HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human gamma glutamyl transpeptidase, GGT in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human gamma glutamyl transpeptidase, GGT ELISA Kit
1-CSB-EL009394HU	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human gamma glutamyl transpeptidase, GGT in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human gamma glutamyl transpeptidase,GGT ELISA Kit
CN-03505H1	ChemNorm	96T	EUR 457

Human gamma glutamyl transpeptidase,GGT ELISA Kit
CN-03505H2	ChemNorm	48T	EUR 306

Human gamma-Glutamyl Carboxylase (GGCX) ELISA Kit
abx387547-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human gamma glutamyl transpeptidase(GGT)ELISA Kit
GA-E1364HM-48T	GenAsia Biotech	48T	EUR 289

Human gamma glutamyl transpeptidase(GGT)ELISA Kit
GA-E1364HM-96T	GenAsia Biotech	96T	EUR 466

Human gamma glutamyl transpeptidase(GGT)ELISA Kit
QY-E04379	Qayee Biotechnology	96T	EUR 361

Mouse gamma glutamyl transpeptidase ELISA Kit
ELA-E1375m	Lifescience Market	96 Tests	EUR 865

Gamma Glutamyl Transferase Assay Kit
55R-1531	Fitzgerald	100 assays	EUR 740
Description: Assay Kit for detection of Gamma Glutamyl Transferase in the research laboratory

Gamma Glutamyl Transferase Assay Kit
55R-1532	Fitzgerald	100 assays	EUR 689
Description: Assay Kit for detection of Gamma Glutamyl Transferase in the research laboratory

Ggh/ Rat Ggh ELISA Kit
ELI-37959r	Lifescience Market	96 Tests	EUR 886

Rat Gamma glutamyl transpeptidase(GGT) ELISA Kit
QY-E11771	Qayee Biotechnology	96T	EUR 374

GGH ELISA KIT|Human
EF007382	Lifescience Market	96 Tests	EUR 689

Gamma-Glutamyl Transpeptidase protein (Bovine)
30-1113	Fitzgerald	1 kU	EUR 155
Description: Purified native Bovine Gamma-Glutamyl Transpeptidase protein

Gamma-Glutamyl Transpeptidase protein (Porcine)
30-1114	Fitzgerald	1 KU	EUR 417
Description: Purified native Porcine Gamma-Glutamyl Transpeptidase protein

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx026095-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx026095-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx214843	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx112671	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx124056	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx242121	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx233444-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx334131	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx432743-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Native Bovine Gamma-Glutamyl Transferase
NATE-0790	Creative Enzymes	2KU	EUR 270

Gamma-Glutamyl Carboxylase (GGCX) Antibody (HRP)
20-abx338281	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (FITC)
20-abx338282	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (Biotin)
20-abx338283	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gamma Glutamyl Transferase (GGT) Activity Colorimetric Assay Kit
K784-100	Biovision		EUR 533

Gamma Glutamyl Transferase (GGT) Activity Fluorometric Assay Kit
K785-100	Biovision		EUR 490

Human Glutamyl aminopeptidase(ENPEP) ELISA kit
E01G0405-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamyl aminopeptidase(ENPEP) ELISA kit
E01G0405-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamyl aminopeptidase(ENPEP) ELISA kit
E01G0405-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamyl-tRNA (QRSL1) ELISA Kit
abx382592-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Glutamyl aminopeptidase, ENPEP ELISA KIT
ELI-49239h	Lifescience Market	96 Tests	EUR 824

Human Glutamyl Aminopeptidase(GluAP)ELISA Kit
QY-E03339	Qayee Biotechnology	96T	EUR 361

Human Glutamyl Aminopeptidase ELISA Kit (GluAP)
RK01475	Abclonal	96 Tests	EUR 521

Human Glutamyl Aminopeptidase (GluAP) ELISA Kit
SEA854Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamyl Aminopeptidase (GluAP) ELISA Kit
SEA854Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamyl Aminopeptidase (GluAP) ELISA Kit
SEA854Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamyl Aminopeptidase (GluAP) ELISA Kit
SEA854Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamyl Aminopeptidase (GluAP) ELISA Kit
4-SEA854Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glutamyl Aminopeptidase elisa. Alternative names of the recognized antigen: CD249 ENPEP gp160 ATA EAP AP-A Aminopeptidase A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glutamyl Aminopeptidase (GluAP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

GGH Antibody
34695-100ul	SAB	100ul	EUR 252

GGH Antibody
34695-50ul	SAB	50ul	EUR 187

GGH antibody
38660-100ul	SAB	100ul	EUR 252

GGH Antibody
1-CSB-PA070154	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

GGH Antibody
CSB-PA789575-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GGH Antibody
CSB-PA789575-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GGH Antibody
DF4073	Affbiotech	200ul	EUR 304
Description: GGH Antibody detects endogenous levels of total GGH.

GGH antibody
70R-36118	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal GGH antibody

GGH Antibody
1-CSB-PA009389LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

GGH siRNA
20-abx902135	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GGH siRNA
20-abx917822	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GGH siRNA
20-abx917823	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GGH Antibody
ABD4073	Lifescience Market	100 ug	EUR 438

Human?-glutamyl systeine synthetase,?-ECS ELISA Kit
201-12-0968	SunredBio	96 tests	EUR 440
This ?-glutamyl systeine synthetase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human GluAP (Glutamyl Aminopeptidase)
ELK5577	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glutamyl Aminopeptidase (GluAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gl Show more
Description: A sandwich ELISA kit for detection of Glutamyl Aminopeptidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Glutamyl-tRNA (QRSL1)
KTE60998-48T	Abbkine	48T	EUR 332
QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha Show more
Description: Quantitative sandwich ELISA for measuring Human Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Glutamyl-tRNA (QRSL1)
KTE60998-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha Show more
Description: Quantitative sandwich ELISA for measuring Human Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Glutamyl-tRNA (QRSL1)
KTE60998-96T	Abbkine	96T	EUR 539
QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha Show more
Description: Quantitative sandwich ELISA for measuring Human Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human GGH shRNA Plasmid
20-abx955832	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GGH Recombinant Protein (Human)
RP013153	ABM	100 ug	Ask for price

Rat Glutamyl aminopeptidase(ENPEP) ELISA kit
E02G0405-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glutamyl aminopeptidase(ENPEP) ELISA kit
E02G0405-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glutamyl aminopeptidase(ENPEP) ELISA kit
E02G0405-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enpep/ Glutamyl aminopeptidase ELISA Kit
E0326Ra	Sunlong	1 Kit	EUR 646

Mouse Glutamyl aminopeptidase(ENPEP) ELISA kit
E03G0405-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glutamyl aminopeptidase(ENPEP) ELISA kit
E03G0405-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glutamyl aminopeptidase(ENPEP) ELISA kit
E03G0405-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutamyl aminopeptidase(ENPEP) ELISA kit
E04G0405-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutamyl aminopeptidase(ENPEP) ELISA kit
E04G0405-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutamyl aminopeptidase(ENPEP) ELISA kit
E04G0405-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glutamyl aminopeptidase(ENPEP) ELISA kit
E06G0405-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glutamyl aminopeptidase(ENPEP) ELISA kit
E06G0405-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glutamyl aminopeptidase(ENPEP) ELISA kit
E06G0405-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glutamyl aminopeptidase(ENPEP) ELISA kit
E09G0405-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glutamyl aminopeptidase(ENPEP) ELISA kit
E09G0405-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glutamyl aminopeptidase(ENPEP) ELISA kit
E09G0405-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Glutamyl aminopeptidase
EK3604	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Glutamyl aminopeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Dog Glutamyl aminopeptidase(ENPEP) ELISA kit
E08G0405-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glutamyl aminopeptidase(ENPEP) ELISA kit
E08G0405-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glutamyl aminopeptidase(ENPEP) ELISA kit
E08G0405-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glutamyl aminopeptidase, Enpep ELISA KIT
ELI-24162m	Lifescience Market	96 Tests	EUR 865

Rat Glutamyl aminopeptidase, Enpep ELISA KIT
ELI-24599r	Lifescience Market	96 Tests	EUR 886

Pig Glutamyl aminopeptidase(ENPEP) ELISA kit
E07G0405-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glutamyl aminopeptidase(ENPEP) ELISA kit
E07G0405-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glutamyl aminopeptidase(ENPEP) ELISA kit
E07G0405-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glutamyl-tRNA (QRSL1) ELISA Kit
abx391388-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Glutamyl-tRNA (QRSL1) ELISA Kit
abx389423-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Enpep(Glutamyl aminopeptidase) ELISA Kit
ER0554	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P50123 Alias: Enpep/Glutamyl aminopeptidase/EAP/Aminopeptidase A/AP-A/CD249
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Porcine Glutamyl aminopeptidase, ENPEP ELISA KIT
ELI-34658p	Lifescience Market	96 Tests	EUR 928

Bovine Glutamyl aminopeptidase, ENPEP ELISA KIT
ELI-49163b	Lifescience Market	96 Tests	EUR 928

Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit
SEA854Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4391.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit
SEA854Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 449.27
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit
SEA854Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 598.96
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit
SEA854Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2395.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit
4-SEA854Mu	Cloud-Clone	EUR 4442.00 EUR 2346.00 EUR 599.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glutamyl Aminopeptidase elisa. Alternative names of the recognized antigen: CD249 ENPEP gp160 ATA EAP AP-A Aminopeptidase A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Glutamyl Aminopeptidase (GluAP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Enpep ELISA Kit| Rat Glutamyl aminopeptidase ELISA Kit
EF017383	Lifescience Market	96 Tests	EUR 689

Enpep ELISA Kit| Mouse Glutamyl aminopeptidase ELISA Kit
EF015054	Lifescience Market	96 Tests	EUR 689

ENPEP ELISA Kit| Bovine Glutamyl aminopeptidase ELISA Kit
EF011431	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human ?-ECS (?-Glutamyl Systeine Synthetase)
E-EL-H1010	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ?-ECS ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ?-ECS. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ?-ECS (?-Glutamyl Systeine Synthetase) in samples from Serum, Plasma, Cell supernatant

Human Glutamyl Aminopeptidase (Aminopeptidase A) (ENPEP) ELISA Kit
20-abx258879	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Glutamyl Aminopeptidase (Aminopeptidase A) (ENPEP) ELISA Kit
abx252050-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Glutamyl Prolyl tRNA Synthetase (EPRS) ELISA Kit
abx387167-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Glutamyl Aminopeptidase (GluAP) CLIA Kit
20-abx496359	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

GGH Blocking Peptide
DF4073-BP	Affbiotech	1mg	EUR 195

GGH Conjugated Antibody
C34695	SAB	100ul	EUR 397

GGH cloning plasmid
CSB-CL852914HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 957 Sequence: atggccagtccgggctgcctgctgtgcgtgctgggcctgctactctgcggggcggcgagcctcgagctgtctagaccccacggcgacaccgccaagaagcccatcatcggaatattaatgcaaaaatgccgtaataaagtcatgaaaaactatggaagatactatattgctgcgtc Show more
Description: A cloning plasmid for the GGH gene.

GGH Rabbit pAb
A5464-100ul	Abclonal	100 ul	EUR 308

GGH Rabbit pAb
A5464-200ul	Abclonal	200 ul	EUR 459

GGH Rabbit pAb
A5464-20ul	Abclonal	20 ul	EUR 183

GGH Rabbit pAb
A5464-50ul	Abclonal	50 ul	EUR 223

GGH Polyclonal Antibody
ABP56886-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300 Applications tips:
Description: A polyclonal antibody for detection of GGH from Human. This GGH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300

GGH Polyclonal Antibody
ABP56886-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300 Applications tips:
Description: A polyclonal antibody for detection of GGH from Human. This GGH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300

GGH Polyclonal Antibody
ABP56886-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300 Applications tips:
Description: A polyclonal antibody for detection of GGH from Human. This GGH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300

GGH Polyclonal Antibody
ES7885-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GGH from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

GGH Polyclonal Antibody
ES7885-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GGH from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-GGH antibody
STJ27417	St John's Laboratory	100 µl	EUR 277
Description: This gene catalyzes the hydrolysis of folylpoly-gamma-glutamates and antifolylpoly-gamma-glutamates by the removal of gamma-linked polyglutamates and glutamate.

Anti-GGH antibody
STJ93263	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to GGH.

Human Glutamyl aminopeptidase (ENPEP)
1-CSB-RP147594h(c)	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 31 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glutamyl aminopeptidase(ENPEP),partial expressed in E.coli

GGH ORF Vector (Human) (pORF)
ORF004385	ABM	1.0 ug DNA	EUR 95

Guinea pig Glutamyl aminopeptidase(ENPEP) ELISA kit
E05G0405-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Glutamyl aminopeptidase(ENPEP) ELISA kit
E05G0405-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Glutamyl aminopeptidase(ENPEP) ELISA kit
E05G0405-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse GluAP (Glutamyl Aminopeptidase)
ELK5148	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glutamyl Aminopeptidase (GluAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gl Show more
Description: A sandwich ELISA kit for detection of Glutamyl Aminopeptidase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Glutamyl-tRNA (QRSL1)
KTE100362-48T	Abbkine	48T	EUR 332
QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha Show more
Description: Quantitative sandwich ELISA for measuring Rat Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Glutamyl-tRNA (QRSL1)
KTE100362-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha Show more
Description: Quantitative sandwich ELISA for measuring Rat Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Glutamyl-tRNA (QRSL1)
KTE100362-96T	Abbkine	96T	EUR 539
QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha Show more
Description: Quantitative sandwich ELISA for measuring Rat Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Glutamyl-tRNA (QRSL1)
KTE10129-48T	Abbkine	48T	EUR 354
QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha Show more
Description: Quantitative sandwich ELISA for measuring Bovine Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Glutamyl-tRNA (QRSL1)
KTE10129-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha Show more
Description: Quantitative sandwich ELISA for measuring Bovine Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human gGH(Gamma-Glutamyl Hydrolase) ELISA Kit