Human gGH(Gamma-Glutamyl Hydrolase) ELISA Kit

Human gGH(Gamma-Glutamyl Hydrolase) ELISA Kit

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit

RDR-gGH-Hu-96Tests 96 Tests
EUR 756

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit

RD-gGH-Hu-48Tests 48 Tests
EUR 521

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit

RD-gGH-Hu-96Tests 96 Tests
EUR 723

Human gamma Glutamyl Hydrolase (gGH) ELISA Kit

20-abx151653
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Gamma-Glutamyl Hydrolase (GGH) ELISA Kit

abx257522-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human GGH(Gamma-glutamyl hydrolase) ELISA Kit

EH4206 96T
EUR 524.1
  • Detection range: 0.469-30 ng/ml
  • Uniprot ID: Q92820
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.281 ng/ml

Human Gamma-glutamyl hydrolase(GGH) ELISA kit

CSB-EL009389HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Gamma-glutamyl hydrolase (GGH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Gamma-glutamyl hydrolase(GGH) ELISA kit

1-CSB-EL009389HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Gamma-glutamyl hydrolase(GGH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Gamma- glutamyl hydrolase, GGH ELISA KIT

ELI-47204h 96 Tests
EUR 824

Human Gamma-Glutamyl Hydrolase ELISA Kit (gGH)

RK01457 96 Tests
EUR 521

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit

SEJ038Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit

SEJ038Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit

SEJ038Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit

SEJ038Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit

4-SEJ038Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Gamma-Glutamyl Hydrolase elisa. Alternative names of the recognized antigen: GH
  • conjugase, folylpolygammaglutamyl hydrolase
  • Gamma-Glu-X carboxypeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Gamma-Glutamyl Hydrolase (gGH) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Gamma-Glutamyl Hydrolase (GGH) Antibody

abx026162-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody

abx026162-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody

abx026577-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody

abx026577-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody

20-abx004184
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody

abx036630-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (gGH) Antibody

20-abx129147
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody

20-abx133717
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (gGH) Antibody

20-abx172517
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Gamma-Glutamyl Hydrolase (GGH) Antibody

20-abx014485
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody

abx330971-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody

20-abx324404
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody

20-abx300931
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody

20-abx302501
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Gamma-Glutamyl Hydrolase (gGH)

4-RPJ038Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92820
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Gamma-Glutamyl Hydrolase expressed in: E.coli

Human Gamma-Glutamyl Hydrolase (gGH) Protein

20-abx166621
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Bovine Gamma- glutamyl hydrolase, GGH ELISA KIT

ELI-31113b 96 Tests
EUR 928

Mouse Gamma- glutamyl hydrolase, Ggh ELISA KIT

ELI-43507m 96 Tests
EUR 865

Rat Gamma-Glutamyl Hydrolase (GGH) ELISA Kit

abx391375-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Gamma-Glutamyl Hydrolase (GGH) ELISA Kit

abx389383-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human gamma Glutamyl Hydrolase (gGH) CLIA Kit

20-abx495599
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human gGH (Gamma-Glutamyl Hydrolase)

ELK3849 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Gamma-Glutamyl Hydrolase (gGH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gam
  • Show more
Description: A sandwich ELISA kit for detection of Gamma-Glutamyl Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-GGH/Gamma Glutamyl Hydrolase Antibody

A03161 100ul
EUR 397
Description: Rabbit Polyclonal GGH/Gamma Glutamyl Hydrolase Antibody. Validated in WB and tested in Human, Mouse.

Gamma-Glutamyl Hydrolase (GGH) Blocking Peptide

20-abx061299
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody (HRP)

20-abx316896
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody (FITC)

20-abx316897
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (GGH) Antibody (Biotin)

20-abx316898
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human)

4-PAJ038Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: gGH (Arg25~Asp318)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH)

Ggh ELISA Kit| Rat Gamma-glutamyl hydrolase ELISA Kit

EF018731 96 Tests
EUR 689

Ggh ELISA Kit| Mouse Gamma-glutamyl hydrolase ELISA Kit

EF015016 96 Tests
EUR 689

GGH ELISA Kit| Bovine Gamma-glutamyl hydrolase ELISA Kit

EF011418 96 Tests
EUR 689

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), APC

4-PAJ038Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: gGH (Arg25~Asp318)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with APC.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), Biotinylated

4-PAJ038Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: gGH (Arg25~Asp318)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with Biotin.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), Cy3

4-PAJ038Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: gGH (Arg25~Asp318)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with Cy3.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), FITC

4-PAJ038Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: gGH (Arg25~Asp318)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with FITC.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), HRP

4-PAJ038Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: gGH (Arg25~Asp318)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with HRP.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), PE

4-PAJ038Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: gGH (Arg25~Asp318)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with PE.

Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), APC-Cy7

4-PAJ038Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: gGH (Arg25~Asp318)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with APC-Cy7.

gamma Glutamyl Hydrolase (Recombinant)

20-abx073267
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Gamma-glutamyl hydrolase Antibody

1-CSB-PA009389LA01GGV
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

Human Glutamyl hydrolase gamma Antibody

32914-05111 150 ug
EUR 261

GGH Gamma-Glutamyl HydrolaseHuman Recombinant Protein

PROTQ92820 Regular: 20ug
EUR 317
Description: GGH Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 315 amino acids (25-318) and having a molecular mass of 35.9kDa.;GGH is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Glycine max Gamma-glutamyl hydrolase

1-CSB-EP009389GGV
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 51.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Glycine max Gamma-glutamyl hydrolase expressed in E.coli

Gamma-glutamyl hydrolase Antibody (HRP)

20-abx300933
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-glutamyl hydrolase Antibody (FITC)

20-abx300934
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-glutamyl hydrolase Antibody (Biotin)

20-abx300935
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-glutamyl hydrolase Antibody, HRP conjugated

1-CSB-PA009389LB01GGV
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is HRP conjugated. Tested in the following application: ELISA

Gamma-glutamyl hydrolase Antibody, FITC conjugated

1-CSB-PA009389LC01GGV
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is FITC conjugated. Tested in the following application: ELISA

Gamma-glutamyl hydrolase Antibody, Biotin conjugated

1-CSB-PA009389LD01GGV
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Glutamyl hydrolase gamma Antibody (Biotin Conjugate)

32914-05121 150 ug
EUR 369

Human Glutamyl hydrolase gamma AssayLite Antibody (FITC Conjugate)

32914-05141 150 ug
EUR 428

Human Glutamyl hydrolase gamma AssayLite Antibody (RPE Conjugate)

32914-05151 150 ug
EUR 428

Human Glutamyl hydrolase gamma AssayLite Antibody (APC Conjugate)

32914-05161 150 ug
EUR 428

Human Glutamyl hydrolase gamma AssayLite Antibody (PerCP Conjugate)

32914-05171 150 ug
EUR 471

Human gamma glutamyl transpeptidase,GGT ELISA Kit

201-12-1348 96 tests
EUR 440
  • This gamma glutamyl transpeptidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human gamma glutamyl transpeptidase, GGT ELISA Kit

CSB-EL009394HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human gamma glutamyl transpeptidase, GGT in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human gamma glutamyl transpeptidase, GGT ELISA Kit

1-CSB-EL009394HU
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human gamma glutamyl transpeptidase, GGT in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human gamma glutamyl transpeptidase,GGT ELISA Kit

CN-03505H1 96T
EUR 457

Human gamma glutamyl transpeptidase,GGT ELISA Kit

CN-03505H2 48T
EUR 306

Human gamma-Glutamyl Carboxylase (GGCX) ELISA Kit

abx387547-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human gamma glutamyl transpeptidase(GGT)ELISA Kit

GA-E1364HM-48T 48T
EUR 289

Human gamma glutamyl transpeptidase(GGT)ELISA Kit

GA-E1364HM-96T 96T
EUR 466

Human gamma glutamyl transpeptidase(GGT)ELISA Kit

QY-E04379 96T
EUR 361

Mouse gamma glutamyl transpeptidase ELISA Kit

ELA-E1375m 96 Tests
EUR 865

Gamma Glutamyl Transferase Assay Kit

55R-1531 100 assays
EUR 740
Description: Assay Kit for detection of Gamma Glutamyl Transferase in the research laboratory

Gamma Glutamyl Transferase Assay Kit

55R-1532 100 assays
EUR 689
Description: Assay Kit for detection of Gamma Glutamyl Transferase in the research laboratory

Ggh/ Rat Ggh ELISA Kit

ELI-37959r 96 Tests
EUR 886

Rat Gamma glutamyl transpeptidase(GGT) ELISA Kit

QY-E11771 96T
EUR 374

GGH ELISA KIT|Human

EF007382 96 Tests
EUR 689

Gamma-Glutamyl Transpeptidase protein (Bovine)

30-1113 1 kU
EUR 155
Description: Purified native Bovine Gamma-Glutamyl Transpeptidase protein

Gamma-Glutamyl Transpeptidase protein (Porcine)

30-1114 1 KU
EUR 417
Description: Purified native Porcine Gamma-Glutamyl Transpeptidase protein

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx026095-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx026095-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx214843
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx112671
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx124056
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx242121
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx233444-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx334131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx432743-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Native Bovine Gamma-Glutamyl Transferase

NATE-0790 2KU
EUR 270

Gamma-Glutamyl Carboxylase (GGCX) Antibody (HRP)

20-abx338281
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (FITC)

20-abx338282
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (Biotin)

20-abx338283
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma Glutamyl Transferase (GGT) Activity Colorimetric Assay Kit

K784-100
EUR 533

Gamma Glutamyl Transferase (GGT) Activity Fluorometric Assay Kit

K785-100
EUR 490

Human Glutamyl aminopeptidase(ENPEP) ELISA kit

E01G0405-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamyl aminopeptidase(ENPEP) ELISA kit

E01G0405-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamyl aminopeptidase(ENPEP) ELISA kit

E01G0405-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamyl-tRNA (QRSL1) ELISA Kit

abx382592-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Glutamyl aminopeptidase, ENPEP ELISA KIT

ELI-49239h 96 Tests
EUR 824

Human Glutamyl Aminopeptidase(GluAP)ELISA Kit

QY-E03339 96T
EUR 361

Human Glutamyl Aminopeptidase ELISA Kit (GluAP)

RK01475 96 Tests
EUR 521

Human Glutamyl Aminopeptidase (GluAP) ELISA Kit

SEA854Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamyl Aminopeptidase (GluAP) ELISA Kit

SEA854Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamyl Aminopeptidase (GluAP) ELISA Kit

SEA854Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamyl Aminopeptidase (GluAP) ELISA Kit

SEA854Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamyl Aminopeptidase (GluAP) ELISA Kit

4-SEA854Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glutamyl Aminopeptidase elisa. Alternative names of the recognized antigen: CD249
  • ENPEP
  • gp160
  • ATA
  • EAP
  • AP-A
  • Aminopeptidase A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glutamyl Aminopeptidase (GluAP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

GGH Antibody

34695-100ul 100ul
EUR 252

GGH Antibody

34695-50ul 50ul
EUR 187

GGH antibody

38660-100ul 100ul
EUR 252

GGH Antibody

1-CSB-PA070154
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

GGH Antibody

CSB-PA789575-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GGH Antibody

CSB-PA789575-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

GGH Antibody

DF4073 200ul
EUR 304
Description: GGH Antibody detects endogenous levels of total GGH.

GGH antibody

70R-36118 100 ug
EUR 327
Description: Rabbit polyclonal GGH antibody

GGH Antibody

1-CSB-PA009389LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

GGH siRNA

20-abx902135
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GGH siRNA

20-abx917822
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GGH siRNA

20-abx917823
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GGH Antibody

ABD4073 100 ug
EUR 438

Human?-glutamyl systeine synthetase,?-ECS ELISA Kit

201-12-0968 96 tests
EUR 440
  • This ?-glutamyl systeine synthetase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human GluAP (Glutamyl Aminopeptidase)

ELK5577 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glutamyl Aminopeptidase (GluAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gl
  • Show more
Description: A sandwich ELISA kit for detection of Glutamyl Aminopeptidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Glutamyl-tRNA (QRSL1)

KTE60998-48T 48T
EUR 332
  • QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Glutamyl-tRNA (QRSL1)

KTE60998-5platesof96wells 5 plates of 96 wells
EUR 2115
  • QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Glutamyl-tRNA (QRSL1)

KTE60998-96T 96T
EUR 539
  • QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human GGH shRNA Plasmid

20-abx955832
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GGH Recombinant Protein (Human)

RP013153 100 ug Ask for price

Rat Glutamyl aminopeptidase(ENPEP) ELISA kit

E02G0405-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glutamyl aminopeptidase(ENPEP) ELISA kit

E02G0405-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glutamyl aminopeptidase(ENPEP) ELISA kit

E02G0405-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Enpep/ Glutamyl aminopeptidase ELISA Kit

E0326Ra 1 Kit
EUR 646

Mouse Glutamyl aminopeptidase(ENPEP) ELISA kit

E03G0405-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glutamyl aminopeptidase(ENPEP) ELISA kit

E03G0405-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glutamyl aminopeptidase(ENPEP) ELISA kit

E03G0405-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutamyl aminopeptidase(ENPEP) ELISA kit

E04G0405-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutamyl aminopeptidase(ENPEP) ELISA kit

E04G0405-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutamyl aminopeptidase(ENPEP) ELISA kit

E04G0405-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glutamyl aminopeptidase(ENPEP) ELISA kit

E06G0405-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glutamyl aminopeptidase(ENPEP) ELISA kit

E06G0405-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glutamyl aminopeptidase(ENPEP) ELISA kit

E06G0405-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glutamyl aminopeptidase(ENPEP) ELISA kit

E09G0405-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glutamyl aminopeptidase(ENPEP) ELISA kit

E09G0405-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glutamyl aminopeptidase(ENPEP) ELISA kit

E09G0405-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Glutamyl aminopeptidase

EK3604 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Glutamyl aminopeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Dog Glutamyl aminopeptidase(ENPEP) ELISA kit

E08G0405-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glutamyl aminopeptidase(ENPEP) ELISA kit

E08G0405-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glutamyl aminopeptidase(ENPEP) ELISA kit

E08G0405-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glutamyl aminopeptidase, Enpep ELISA KIT

ELI-24162m 96 Tests
EUR 865

Rat Glutamyl aminopeptidase, Enpep ELISA KIT

ELI-24599r 96 Tests
EUR 886

Pig Glutamyl aminopeptidase(ENPEP) ELISA kit

E07G0405-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glutamyl aminopeptidase(ENPEP) ELISA kit

E07G0405-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glutamyl aminopeptidase(ENPEP) ELISA kit

E07G0405-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glutamyl-tRNA (QRSL1) ELISA Kit

abx391388-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Glutamyl-tRNA (QRSL1) ELISA Kit

abx389423-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Enpep(Glutamyl aminopeptidase) ELISA Kit

ER0554 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P50123
  • Alias: Enpep/Glutamyl aminopeptidase/EAP/Aminopeptidase A/AP-A/CD249
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Porcine Glutamyl aminopeptidase, ENPEP ELISA KIT

ELI-34658p 96 Tests
EUR 928

Bovine Glutamyl aminopeptidase, ENPEP ELISA KIT

ELI-49163b 96 Tests
EUR 928

Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit

SEA854Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit

SEA854Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit

SEA854Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit

SEA854Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit

4-SEA854Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glutamyl Aminopeptidase elisa. Alternative names of the recognized antigen: CD249
  • ENPEP
  • gp160
  • ATA
  • EAP
  • AP-A
  • Aminopeptidase A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Glutamyl Aminopeptidase (GluAP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Enpep ELISA Kit| Rat Glutamyl aminopeptidase ELISA Kit

EF017383 96 Tests
EUR 689

Enpep ELISA Kit| Mouse Glutamyl aminopeptidase ELISA Kit

EF015054 96 Tests
EUR 689

ENPEP ELISA Kit| Bovine Glutamyl aminopeptidase ELISA Kit

EF011431 96 Tests
EUR 689

ELISA kit for Human ?-ECS (?-Glutamyl Systeine Synthetase)

E-EL-H1010 1 plate of 96 wells
EUR 534
  • Gentaur's ?-ECS ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ?-ECS. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ?-ECS (?-Glutamyl Systeine Synthetase) in samples from Serum, Plasma, Cell supernatant

Human Glutamyl Aminopeptidase (Aminopeptidase A) (ENPEP) ELISA Kit

20-abx258879
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glutamyl Aminopeptidase (Aminopeptidase A) (ENPEP) ELISA Kit

abx252050-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Glutamyl Prolyl tRNA Synthetase (EPRS) ELISA Kit

abx387167-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Glutamyl Aminopeptidase (GluAP) CLIA Kit

20-abx496359
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

GGH Blocking Peptide

DF4073-BP 1mg
EUR 195

GGH Conjugated Antibody

C34695 100ul
EUR 397

GGH cloning plasmid

CSB-CL852914HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 957
  • Sequence: atggccagtccgggctgcctgctgtgcgtgctgggcctgctactctgcggggcggcgagcctcgagctgtctagaccccacggcgacaccgccaagaagcccatcatcggaatattaatgcaaaaatgccgtaataaagtcatgaaaaactatggaagatactatattgctgcgtc
  • Show more
Description: A cloning plasmid for the GGH gene.

GGH Rabbit pAb

A5464-100ul 100 ul
EUR 308

GGH Rabbit pAb

A5464-200ul 200 ul
EUR 459

GGH Rabbit pAb

A5464-20ul 20 ul
EUR 183

GGH Rabbit pAb

A5464-50ul 50 ul
EUR 223

GGH Polyclonal Antibody

ABP56886-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of GGH from Human. This GGH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300

GGH Polyclonal Antibody

ABP56886-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of GGH from Human. This GGH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300

GGH Polyclonal Antibody

ABP56886-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of GGH from Human. This GGH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300

GGH Polyclonal Antibody

ES7885-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GGH from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

GGH Polyclonal Antibody

ES7885-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GGH from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-GGH antibody

STJ27417 100 µl
EUR 277
Description: This gene catalyzes the hydrolysis of folylpoly-gamma-glutamates and antifolylpoly-gamma-glutamates by the removal of gamma-linked polyglutamates and glutamate.

Anti-GGH antibody

STJ93263 200 µl
EUR 197
Description: Rabbit polyclonal to GGH.

Human Glutamyl aminopeptidase (ENPEP)

1-CSB-RP147594h(c)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glutamyl aminopeptidase(ENPEP),partial expressed in E.coli

GGH ORF Vector (Human) (pORF)

ORF004385 1.0 ug DNA
EUR 95

Guinea pig Glutamyl aminopeptidase(ENPEP) ELISA kit

E05G0405-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Glutamyl aminopeptidase(ENPEP) ELISA kit

E05G0405-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Glutamyl aminopeptidase(ENPEP) ELISA kit

E05G0405-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse GluAP (Glutamyl Aminopeptidase)

ELK5148 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glutamyl Aminopeptidase (GluAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gl
  • Show more
Description: A sandwich ELISA kit for detection of Glutamyl Aminopeptidase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Glutamyl-tRNA (QRSL1)

KTE100362-48T 48T
EUR 332
  • QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Glutamyl-tRNA (QRSL1)

KTE100362-5platesof96wells 5 plates of 96 wells
EUR 2115
  • QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Glutamyl-tRNA (QRSL1)

KTE100362-96T 96T
EUR 539
  • QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Glutamyl-tRNA (QRSL1)

KTE10129-48T 48T
EUR 354
  • QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Glutamyl-tRNA (QRSL1)

KTE10129-5platesof96wells 5 plates of 96 wells
EUR 2252
  • QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human gGH(Gamma-Glutamyl Hydrolase) ELISA Kit