Human gGH(Gamma-Glutamyl Hydrolase) ELISA Kit
Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit |
RDR-gGH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit |
RD-gGH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit |
RD-gGH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human gamma Glutamyl Hydrolase (gGH) ELISA Kit |
20-abx151653 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Gamma-Glutamyl Hydrolase (GGH) ELISA Kit |
abx257522-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human GGH(Gamma-glutamyl hydrolase) ELISA Kit |
EH4206 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.469-30 ng/ml
- Uniprot ID: Q92820
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.281 ng/ml |
Human Gamma-glutamyl hydrolase(GGH) ELISA kit |
CSB-EL009389HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Gamma-glutamyl hydrolase (GGH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Gamma-glutamyl hydrolase(GGH) ELISA kit |
1-CSB-EL009389HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Gamma-glutamyl hydrolase(GGH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Gamma- glutamyl hydrolase, GGH ELISA KIT |
ELI-47204h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Gamma-Glutamyl Hydrolase ELISA Kit (gGH) |
RK01457 |
Abclonal |
96 Tests |
EUR 521 |
Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit |
SEJ038Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit |
SEJ038Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit |
SEJ038Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit |
SEJ038Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gamma-Glutamyl Hydrolase (gGH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gamma-Glutamyl Hydrolase (gGH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit |
4-SEJ038Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Gamma-Glutamyl Hydrolase elisa. Alternative names of the recognized antigen: GH
- conjugase, folylpolygammaglutamyl hydrolase
- Gamma-Glu-X carboxypeptidase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Gamma-Glutamyl Hydrolase (gGH) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Gamma-Glutamyl Hydrolase (GGH) Antibody |
abx026162-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
abx026162-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
abx026577-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
abx026577-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
20-abx004184 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
abx036630-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (gGH) Antibody |
20-abx129147 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
20-abx133717 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (gGH) Antibody |
20-abx172517 |
Abbexa |
|
|
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
20-abx014485 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
abx330971-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
20-abx324404 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
20-abx300931 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody |
20-abx302501 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Gamma-Glutamyl Hydrolase (gGH) |
4-RPJ038Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q92820
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 37.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Gamma-Glutamyl Hydrolase expressed in: E.coli |
Human Gamma-Glutamyl Hydrolase (gGH) Protein |
20-abx166621 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Bovine Gamma- glutamyl hydrolase, GGH ELISA KIT |
ELI-31113b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Gamma- glutamyl hydrolase, Ggh ELISA KIT |
ELI-43507m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat Gamma-Glutamyl Hydrolase (GGH) ELISA Kit |
abx391375-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Gamma-Glutamyl Hydrolase (GGH) ELISA Kit |
abx389383-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human gamma Glutamyl Hydrolase (gGH) CLIA Kit |
20-abx495599 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human gGH (Gamma-Glutamyl Hydrolase) |
ELK3849 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Gamma-Glutamyl Hydrolase (gGH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gam
- Show more
|
Description: A sandwich ELISA kit for detection of Gamma-Glutamyl Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Anti-GGH/Gamma Glutamyl Hydrolase Antibody |
A03161 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal GGH/Gamma Glutamyl Hydrolase Antibody. Validated in WB and tested in Human, Mouse. |
Gamma-Glutamyl Hydrolase (GGH) Blocking Peptide |
20-abx061299 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody (HRP) |
20-abx316896 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody (FITC) |
20-abx316897 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (GGH) Antibody (Biotin) |
20-abx316898 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human) |
4-PAJ038Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: gGH (Arg25~Asp318)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH) |
Ggh ELISA Kit| Rat Gamma-glutamyl hydrolase ELISA Kit |
EF018731 |
Lifescience Market |
96 Tests |
EUR 689 |
Ggh ELISA Kit| Mouse Gamma-glutamyl hydrolase ELISA Kit |
EF015016 |
Lifescience Market |
96 Tests |
EUR 689 |
GGH ELISA Kit| Bovine Gamma-glutamyl hydrolase ELISA Kit |
EF011418 |
Lifescience Market |
96 Tests |
EUR 689 |
Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), APC |
4-PAJ038Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: gGH (Arg25~Asp318)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with APC. |
Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), Biotinylated |
4-PAJ038Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: gGH (Arg25~Asp318)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with Biotin. |
Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), Cy3 |
4-PAJ038Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: gGH (Arg25~Asp318)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with Cy3. |
Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), FITC |
4-PAJ038Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: gGH (Arg25~Asp318)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with FITC. |
Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), HRP |
4-PAJ038Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: gGH (Arg25~Asp318)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with HRP. |
Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), PE |
4-PAJ038Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: gGH (Arg25~Asp318)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with PE. |
Gamma-Glutamyl Hydrolase (gGH) Polyclonal Antibody (Human), APC-Cy7 |
4-PAJ038Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: gGH (Arg25~Asp318)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Gamma-Glutamyl Hydrolase (gGH). This antibody is labeled with APC-Cy7. |
gamma Glutamyl Hydrolase (Recombinant) |
20-abx073267 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Gamma-glutamyl hydrolase Antibody |
1-CSB-PA009389LA01GGV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
Human Glutamyl hydrolase gamma Antibody |
32914-05111 |
AssayPro |
150 ug |
EUR 261 |
GGH Gamma-Glutamyl HydrolaseHuman Recombinant Protein |
PROTQ92820 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: GGH Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 315 amino acids (25-318) and having a molecular mass of 35.9kDa.;GGH is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Glycine max Gamma-glutamyl hydrolase |
1-CSB-EP009389GGV |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 51.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Glycine max Gamma-glutamyl hydrolase expressed in E.coli |
Gamma-glutamyl hydrolase Antibody (HRP) |
20-abx300933 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gamma-glutamyl hydrolase Antibody (FITC) |
20-abx300934 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gamma-glutamyl hydrolase Antibody (Biotin) |
20-abx300935 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gamma-glutamyl hydrolase Antibody, HRP conjugated |
1-CSB-PA009389LB01GGV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is HRP conjugated. Tested in the following application: ELISA |
Gamma-glutamyl hydrolase Antibody, FITC conjugated |
1-CSB-PA009389LC01GGV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is FITC conjugated. Tested in the following application: ELISA |
Gamma-glutamyl hydrolase Antibody, Biotin conjugated |
1-CSB-PA009389LD01GGV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Gamma-glutamyl hydrolase. Recognizes Gamma-glutamyl hydrolase from Glycine max. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human Glutamyl hydrolase gamma Antibody (Biotin Conjugate) |
32914-05121 |
AssayPro |
150 ug |
EUR 369 |
Human Glutamyl hydrolase gamma AssayLite Antibody (FITC Conjugate) |
32914-05141 |
AssayPro |
150 ug |
EUR 428 |
Human Glutamyl hydrolase gamma AssayLite Antibody (RPE Conjugate) |
32914-05151 |
AssayPro |
150 ug |
EUR 428 |
Human Glutamyl hydrolase gamma AssayLite Antibody (APC Conjugate) |
32914-05161 |
AssayPro |
150 ug |
EUR 428 |
Human Glutamyl hydrolase gamma AssayLite Antibody (PerCP Conjugate) |
32914-05171 |
AssayPro |
150 ug |
EUR 471 |
Human gamma glutamyl transpeptidase,GGT ELISA Kit |
201-12-1348 |
SunredBio |
96 tests |
EUR 440 |
- This gamma glutamyl transpeptidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human gamma glutamyl transpeptidase, GGT ELISA Kit |
CSB-EL009394HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human gamma glutamyl transpeptidase, GGT in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human gamma glutamyl transpeptidase, GGT ELISA Kit |
1-CSB-EL009394HU |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human gamma glutamyl transpeptidase, GGT in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human gamma glutamyl transpeptidase,GGT ELISA Kit |
CN-03505H1 |
ChemNorm |
96T |
EUR 457 |
Human gamma glutamyl transpeptidase,GGT ELISA Kit |
CN-03505H2 |
ChemNorm |
48T |
EUR 306 |
Human gamma-Glutamyl Carboxylase (GGCX) ELISA Kit |
abx387547-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human gamma glutamyl transpeptidase(GGT)ELISA Kit |
GA-E1364HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human gamma glutamyl transpeptidase(GGT)ELISA Kit |
GA-E1364HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Mouse gamma glutamyl transpeptidase ELISA Kit |
ELA-E1375m |
Lifescience Market |
96 Tests |
EUR 865 |
Gamma Glutamyl Transferase Assay Kit |
55R-1531 |
Fitzgerald |
100 assays |
EUR 740 |
Description: Assay Kit for detection of Gamma Glutamyl Transferase in the research laboratory |
Gamma Glutamyl Transferase Assay Kit |
55R-1532 |
Fitzgerald |
100 assays |
EUR 689 |
Description: Assay Kit for detection of Gamma Glutamyl Transferase in the research laboratory |
Gamma-Glutamyl Transpeptidase protein (Bovine) |
30-1113 |
Fitzgerald |
1 kU |
EUR 155 |
Description: Purified native Bovine Gamma-Glutamyl Transpeptidase protein |
Gamma-Glutamyl Transpeptidase protein (Porcine) |
30-1114 |
Fitzgerald |
1 KU |
EUR 417 |
Description: Purified native Porcine Gamma-Glutamyl Transpeptidase protein |
gamma-Glutamyl Carboxylase (GGCX) Antibody |
abx026095-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
gamma-Glutamyl Carboxylase (GGCX) Antibody |
abx026095-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Carboxylase (GGCX) Antibody |
20-abx214843 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Carboxylase (GGCX) Antibody |
20-abx112671 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
gamma-Glutamyl Carboxylase (GGCX) Antibody |
20-abx124056 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Carboxylase (GGCX) Antibody |
20-abx242121 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
gamma-Glutamyl Carboxylase (GGCX) Antibody |
abx233444-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Gamma-Glutamyl Carboxylase (GGCX) Antibody |
20-abx334131 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
gamma-Glutamyl Carboxylase (GGCX) Antibody |
abx432743-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Gamma-Glutamyl Carboxylase (GGCX) Antibody (HRP) |
20-abx338281 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Carboxylase (GGCX) Antibody (FITC) |
20-abx338282 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gamma-Glutamyl Carboxylase (GGCX) Antibody (Biotin) |
20-abx338283 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gamma Glutamyl Transferase (GGT) Activity Colorimetric Assay Kit |
K784-100 |
Biovision |
|
EUR 533 |
Gamma Glutamyl Transferase (GGT) Activity Fluorometric Assay Kit |
K785-100 |
Biovision |
|
EUR 490 |
Human Glutamyl aminopeptidase(ENPEP) ELISA kit |
E01G0405-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutamyl aminopeptidase(ENPEP) ELISA kit |
E01G0405-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutamyl aminopeptidase(ENPEP) ELISA kit |
E01G0405-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutamyl-tRNA (QRSL1) ELISA Kit |
abx382592-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Glutamyl aminopeptidase, ENPEP ELISA KIT |
ELI-49239h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Glutamyl Aminopeptidase ELISA Kit (GluAP) |
RK01475 |
Abclonal |
96 Tests |
EUR 521 |
Human Glutamyl Aminopeptidase (GluAP) ELISA Kit |
SEA854Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids. |
Human Glutamyl Aminopeptidase (GluAP) ELISA Kit |
SEA854Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids. |
Human Glutamyl Aminopeptidase (GluAP) ELISA Kit |
SEA854Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids. |
Human Glutamyl Aminopeptidase (GluAP) ELISA Kit |
SEA854Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamyl Aminopeptidase (GluAP) in tissue homogenates, cell lysates and other biological fluids. |
Human Glutamyl Aminopeptidase (GluAP) ELISA Kit |
4-SEA854Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Glutamyl Aminopeptidase elisa. Alternative names of the recognized antigen: CD249
- ENPEP
- gp160
- ATA
- EAP
- AP-A
- Aminopeptidase A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glutamyl Aminopeptidase (GluAP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
GGH Antibody |
34695-100ul |
SAB |
100ul |
EUR 252 |
GGH Antibody |
34695-50ul |
SAB |
50ul |
EUR 187 |
GGH antibody |
38660-100ul |
SAB |
100ul |
EUR 252 |
GGH Antibody |
1-CSB-PA070154 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
GGH Antibody |
CSB-PA789575- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
GGH Antibody |
CSB-PA789575-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
GGH Antibody |
DF4073 |
Affbiotech |
200ul |
EUR 304 |
Description: GGH Antibody detects endogenous levels of total GGH. |
GGH antibody |
70R-36118 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal GGH antibody |
GGH Antibody |
1-CSB-PA009389LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GGH. Recognizes GGH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
GGH siRNA |
20-abx902135 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GGH siRNA |
20-abx917822 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GGH siRNA |
20-abx917823 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human?-glutamyl systeine synthetase,?-ECS ELISA Kit |
201-12-0968 |
SunredBio |
96 tests |
EUR 440 |
- This ?-glutamyl systeine synthetase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA kit for Human GluAP (Glutamyl Aminopeptidase) |
ELK5577 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glutamyl Aminopeptidase (GluAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gl
- Show more
|
Description: A sandwich ELISA kit for detection of Glutamyl Aminopeptidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Glutamyl-tRNA (QRSL1) |
KTE60998-48T |
Abbkine |
48T |
EUR 332 |
- QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Glutamyl-tRNA (QRSL1) |
KTE60998-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Glutamyl-tRNA (QRSL1) |
KTE60998-96T |
Abbkine |
96T |
EUR 539 |
- QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human GGH shRNA Plasmid |
20-abx955832 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GGH Recombinant Protein (Human) |
RP013153 |
ABM |
100 ug |
Ask for price |
Rat Glutamyl aminopeptidase(ENPEP) ELISA kit |
E02G0405-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Glutamyl aminopeptidase(ENPEP) ELISA kit |
E02G0405-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Glutamyl aminopeptidase(ENPEP) ELISA kit |
E02G0405-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enpep/ Glutamyl aminopeptidase ELISA Kit |
E0326Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Glutamyl aminopeptidase(ENPEP) ELISA kit |
E03G0405-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Glutamyl aminopeptidase(ENPEP) ELISA kit |
E03G0405-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Glutamyl aminopeptidase(ENPEP) ELISA kit |
E03G0405-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Glutamyl aminopeptidase(ENPEP) ELISA kit |
E04G0405-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Glutamyl aminopeptidase(ENPEP) ELISA kit |
E04G0405-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Glutamyl aminopeptidase(ENPEP) ELISA kit |
E04G0405-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Glutamyl aminopeptidase(ENPEP) ELISA kit |
E06G0405-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Glutamyl aminopeptidase(ENPEP) ELISA kit |
E06G0405-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Glutamyl aminopeptidase(ENPEP) ELISA kit |
E06G0405-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Glutamyl aminopeptidase(ENPEP) ELISA kit |
E09G0405-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Glutamyl aminopeptidase(ENPEP) ELISA kit |
E09G0405-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Glutamyl aminopeptidase(ENPEP) ELISA kit |
E09G0405-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Rat Glutamyl aminopeptidase |
EK3604 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Glutamyl aminopeptidase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Dog Glutamyl aminopeptidase(ENPEP) ELISA kit |
E08G0405-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Glutamyl aminopeptidase(ENPEP) ELISA kit |
E08G0405-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Glutamyl aminopeptidase(ENPEP) ELISA kit |
E08G0405-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Glutamyl aminopeptidase, Enpep ELISA KIT |
ELI-24162m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat Glutamyl aminopeptidase, Enpep ELISA KIT |
ELI-24599r |
Lifescience Market |
96 Tests |
EUR 886 |
Pig Glutamyl aminopeptidase(ENPEP) ELISA kit |
E07G0405-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Glutamyl aminopeptidase(ENPEP) ELISA kit |
E07G0405-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Glutamyl aminopeptidase(ENPEP) ELISA kit |
E07G0405-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Glutamyl-tRNA (QRSL1) ELISA Kit |
abx391388-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Glutamyl-tRNA (QRSL1) ELISA Kit |
abx389423-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Enpep(Glutamyl aminopeptidase) ELISA Kit |
ER0554 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P50123
- Alias: Enpep/Glutamyl aminopeptidase/EAP/Aminopeptidase A/AP-A/CD249
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml |
Porcine Glutamyl aminopeptidase, ENPEP ELISA KIT |
ELI-34658p |
Lifescience Market |
96 Tests |
EUR 928 |
Bovine Glutamyl aminopeptidase, ENPEP ELISA KIT |
ELI-49163b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit |
SEA854Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit |
SEA854Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit |
SEA854Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit |
SEA854Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutamyl Aminopeptidase (GluAP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutamyl Aminopeptidase (GluAP) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Glutamyl Aminopeptidase (GluAP) ELISA Kit |
4-SEA854Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Glutamyl Aminopeptidase elisa. Alternative names of the recognized antigen: CD249
- ENPEP
- gp160
- ATA
- EAP
- AP-A
- Aminopeptidase A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Glutamyl Aminopeptidase (GluAP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Enpep ELISA Kit| Rat Glutamyl aminopeptidase ELISA Kit |
EF017383 |
Lifescience Market |
96 Tests |
EUR 689 |
Enpep ELISA Kit| Mouse Glutamyl aminopeptidase ELISA Kit |
EF015054 |
Lifescience Market |
96 Tests |
EUR 689 |
ENPEP ELISA Kit| Bovine Glutamyl aminopeptidase ELISA Kit |
EF011431 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Human ?-ECS (?-Glutamyl Systeine Synthetase) |
E-EL-H1010 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ?-ECS ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ?-ECS. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human ?-ECS (?-Glutamyl Systeine Synthetase) in samples from Serum, Plasma, Cell supernatant |
Human Glutamyl Aminopeptidase (Aminopeptidase A) (ENPEP) ELISA Kit |
20-abx258879 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Glutamyl Aminopeptidase (Aminopeptidase A) (ENPEP) ELISA Kit |
abx252050-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Glutamyl Prolyl tRNA Synthetase (EPRS) ELISA Kit |
abx387167-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Glutamyl Aminopeptidase (GluAP) CLIA Kit |
20-abx496359 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
GGH Blocking Peptide |
DF4073-BP |
Affbiotech |
1mg |
EUR 195 |
GGH Conjugated Antibody |
C34695 |
SAB |
100ul |
EUR 397 |
GGH cloning plasmid |
CSB-CL852914HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 957
- Sequence: atggccagtccgggctgcctgctgtgcgtgctgggcctgctactctgcggggcggcgagcctcgagctgtctagaccccacggcgacaccgccaagaagcccatcatcggaatattaatgcaaaaatgccgtaataaagtcatgaaaaactatggaagatactatattgctgcgtc
- Show more
|
Description: A cloning plasmid for the GGH gene. |
GGH Rabbit pAb |
A5464-100ul |
Abclonal |
100 ul |
EUR 308 |
GGH Rabbit pAb |
A5464-200ul |
Abclonal |
200 ul |
EUR 459 |
GGH Rabbit pAb |
A5464-20ul |
Abclonal |
20 ul |
EUR 183 |
GGH Rabbit pAb |
A5464-50ul |
Abclonal |
50 ul |
EUR 223 |
GGH Polyclonal Antibody |
ABP56886-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of GGH from Human. This GGH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300 |
GGH Polyclonal Antibody |
ABP56886-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of GGH from Human. This GGH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300 |
GGH Polyclonal Antibody |
ABP56886-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of GGH from Human. This GGH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GGH at AA range: 220-300 |
GGH Polyclonal Antibody |
ES7885-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GGH from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
GGH Polyclonal Antibody |
ES7885-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GGH from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Anti-GGH antibody |
STJ27417 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene catalyzes the hydrolysis of folylpoly-gamma-glutamates and antifolylpoly-gamma-glutamates by the removal of gamma-linked polyglutamates and glutamate. |
Anti-GGH antibody |
STJ93263 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to GGH. |
Human Glutamyl aminopeptidase (ENPEP) |
1-CSB-RP147594h(c) |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 31 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Glutamyl aminopeptidase(ENPEP),partial expressed in E.coli |
GGH ORF Vector (Human) (pORF) |
ORF004385 |
ABM |
1.0 ug DNA |
EUR 95 |
Guinea pig Glutamyl aminopeptidase(ENPEP) ELISA kit |
E05G0405-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Glutamyl aminopeptidase(ENPEP) ELISA kit |
E05G0405-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Glutamyl aminopeptidase(ENPEP) ELISA kit |
E05G0405-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Glutamyl aminopeptidase(ENPEP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Mouse GluAP (Glutamyl Aminopeptidase) |
ELK5148 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glutamyl Aminopeptidase (GluAP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gl
- Show more
|
Description: A sandwich ELISA kit for detection of Glutamyl Aminopeptidase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat Glutamyl-tRNA (QRSL1) |
KTE100362-48T |
Abbkine |
48T |
EUR 332 |
- QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Glutamyl-tRNA (QRSL1) |
KTE100362-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Glutamyl-tRNA (QRSL1) |
KTE100362-96T |
Abbkine |
96T |
EUR 539 |
- QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Glutamyl-tRNA (QRSL1) |
KTE10129-48T |
Abbkine |
48T |
EUR 354 |
- QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Glutamyl-tRNA (QRSL1) |
KTE10129-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- QRSL1 belongs to the amidase family, similar to glutaminyl-tRNA synthetase. Glutaminyl-tRNA synthetase is a class Ic synthetase and shows several similarities with glutamyl-tRNA synthetase concerning structure and catalytic properties. It is an alpha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Glutamyl-tRNA (QRSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human gGH(Gamma-Glutamyl Hydrolase) ELISA Kit