Human FLCN(Folliculin) ELISA Kit
Human Folliculin (FLCN) ELISA Kit |
RD-FLCN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Folliculin (FLCN) ELISA Kit |
RD-FLCN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Folliculin (FLCN) ELISA Kit |
RDR-FLCN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Folliculin (FLCN) ELISA Kit |
RDR-FLCN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Folliculin (FLCN) ELISA Kit |
20-abx151577 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Folliculin(FLCN) ELISA kit |
CSB-EL008711HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Folliculin (FLCN) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Folliculin(FLCN) ELISA kit |
1-CSB-EL008711HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Folliculin(FLCN) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Folliculin (FLCN) ELISA Kit |
SEJ102Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids. |
Human Folliculin (FLCN) ELISA Kit |
SEJ102Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids. |
Human Folliculin (FLCN) ELISA Kit |
SEJ102Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids. |
Human Folliculin (FLCN) ELISA Kit |
SEJ102Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids. |
Human Folliculin (FLCN) ELISA Kit |
4-SEJ102Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Folliculin elisa. Alternative names of the recognized antigen: BHD
- FLCL
- BHD skin lesion fibrofolliculoma protein
- Birt-Hogg-Dube syndrome protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Folliculin (FLCN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Folliculin (FLCN) ELISA Kit |
abx389320-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Folliculin (FLCN) ELISA Kit |
abx391347-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Folliculin (FLCN) Antibody |
20-abx126912 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Folliculin (FLCN) Antibody |
20-abx112567 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Folliculin (FLCN) Antibody |
20-abx100526 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Folliculin (FLCN) Antibody |
abx034049-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Folliculin (FLCN) Antibody |
abx034049-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Folliculin (FLCN) Antibody |
20-abx004978 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Folliculin (FLCN) Antibody |
20-abx172456 |
Abbexa |
|
|
|
Folliculin (FLCN) Antibody |
20-abx176486 |
Abbexa |
|
|
|
Folliculin (FLCN) Antibody |
20-abx176487 |
Abbexa |
|
|
|
Folliculin (FLCN) Antibody |
20-abx213763 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Folliculin (FLCN) Antibody |
20-abx214841 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Folliculin (FLCN) Antibody |
abx233157-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
ELISA kit for Human FLCN (Folliculin) |
ELK3954 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Folliculin (FLCN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Folliculin (FLCN
- Show more
|
Description: A sandwich ELISA kit for detection of Folliculin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Folliculin (FLCN) CLIA Kit |
20-abx495616 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Folliculin (FLCN) Protein |
20-abx653446 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Folliculin (FLCN) Antibody (Biotin) |
20-abx271837 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Recombinant human FLCN |
P1429 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q8NFG4
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human FLCN |
Human Folliculin- interacting protein 1, FNIP1 ELISA KIT |
ELI-09886h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Folliculin- interacting protein 2, FNIP2 ELISA KIT |
ELI-27534h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Folliculin Interacting Protein 1 (FNIP1) ELISA Kit |
abx387393-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
FLCN siRNA |
20-abx901981 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FLCN siRNA |
20-abx916958 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FLCN siRNA |
20-abx916959 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FLCN Antibody |
36486-100ul |
SAB |
100ul |
EUR 252 |
FLCN antibody |
38963-100ul |
SAB |
100ul |
EUR 252 |
FLCN antibody |
70R-17318 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FLCN antibody |
FLCN antibody |
70R-10330 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal FLCN antibody |
FLCN antibody |
70R-10331 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal FLCN antibody |
FLCN Antibody |
DF12608 |
Affbiotech |
200ul |
EUR 304 |
Description: FLCN Antibody detects endogenous levels of FLCN. |
FLCN Antibody |
1-CSB-PA797254 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300 |
FLCN Antibody |
1-CSB-PA549292 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
FLCN Antibody |
1-CSB-PA008711GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
FLCN Antibody |
1-CSB-PA008711HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
anti-FLCN |
YF-PA22691 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to FLCN |
anti-FLCN |
YF-PA26966 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to FLCN |
anti-FLCN |
YF-PA26967 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to FLCN |
Human FLCN shRNA Plasmid |
20-abx966277 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FLCN Recombinant Protein (Human) |
RP012259 |
ABM |
100 ug |
Ask for price |
Mouse Folliculin- interacting protein 1, Fnip1 ELISA KIT |
ELI-27518m |
Lifescience Market |
96 Tests |
EUR 865 |
Chicken Folliculin- interacting protein 1, FNIP1 ELISA KIT |
ELI-32867c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Folliculin- interacting protein 2, Fnip2 ELISA KIT |
ELI-47311m |
Lifescience Market |
96 Tests |
EUR 865 |
FLCN Conjugated Antibody |
C36486 |
SAB |
100ul |
EUR 397 |
FLCN cloning plasmid |
CSB-CL008711HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1029
- Sequence: atgaatgccatcgtggctctctgccacttctgcgagctccacggcccccgcactctcttctgcacggaggtgctgcacgccccacttcctcaaggggatgggaatgaggacagtcctggccagggtgagcaggcggaagaagaggaaggtggcattcagatgaacagtcggatgc
- Show more
|
Description: A cloning plasmid for the FLCN gene. |
anti- FLCN antibody |
FNab03157 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: folliculin
- Uniprot ID: Q8NFG4
- Gene ID: 201163
- Research Area: Cancer
|
Description: Antibody raised against FLCN |
Anti-FLCN Antibody |
A00718-1 |
BosterBio |
100ug/vial |
EUR 294 |
FLCN Rabbit pAb |
A11849-100ul |
Abclonal |
100 ul |
EUR 308 |
FLCN Rabbit pAb |
A11849-200ul |
Abclonal |
200 ul |
EUR 459 |
FLCN Rabbit pAb |
A11849-20ul |
Abclonal |
20 ul |
Ask for price |
FLCN Rabbit pAb |
A11849-50ul |
Abclonal |
50 ul |
Ask for price |
FLCN Rabbit pAb |
A14521-100ul |
Abclonal |
100 ul |
EUR 308 |
FLCN Rabbit pAb |
A14521-200ul |
Abclonal |
200 ul |
EUR 459 |
FLCN Rabbit pAb |
A14521-20ul |
Abclonal |
20 ul |
EUR 183 |
FLCN Rabbit pAb |
A14521-50ul |
Abclonal |
50 ul |
EUR 223 |
FLCN Rabbit pAb |
A6493-100ul |
Abclonal |
100 ul |
EUR 308 |
FLCN Rabbit pAb |
A6493-200ul |
Abclonal |
200 ul |
EUR 459 |
FLCN Rabbit pAb |
A6493-20ul |
Abclonal |
20 ul |
EUR 183 |
FLCN Rabbit pAb |
A6493-50ul |
Abclonal |
50 ul |
EUR 223 |
FLCN Blocking Peptide |
33R-10310 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FLCN antibody, catalog no. 70R-10331 |
Human FLCN(Folliculin) ELISA Kit