Human EXT1(Exostoses 1) ELISA Kit

Human EXT1(Exostoses 1) ELISA Kit

Human Exostoses 1 (EXT1) ELISA Kit

RDR-EXT1-Hu-48Tests 48 Tests
EUR 544

Human Exostoses 1 (EXT1) ELISA Kit

RDR-EXT1-Hu-96Tests 96 Tests
EUR 756

Human EXT1(Exostoses 1) ELISA Kit

EH3023 96T
EUR 524.1
  • Detection range: 0.781-50 ng/ml
  • Uniprot ID: Q16394
  • Alias: EXT1/LGCR/TRPS2/TTV/EC 1/exostosin 1/exostosin-1/EXT/Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase/Glucurono
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Exostoses 1 (EXT1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Exostoses 1 (EXT1) ELISA Kit

abx252416-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Exostoses 1 (EXT1)ELISA Kit

201-12-2693 96 tests
EUR 440
  • This Exostoses 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Exostoses 1 ELISA Kit (EXT1)

RK01332 96 Tests
EUR 521

Human Exostoses 1(EXT1)ELISA Kit

QY-E01126 96T
EUR 361

Human Exostoses 1 (EXT1) ELISA Kit

SEG239Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

Human Exostoses 1 (EXT1) ELISA Kit

SEG239Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

Human Exostoses 1 (EXT1) ELISA Kit

SEG239Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

Human Exostoses 1 (EXT1) ELISA Kit

SEG239Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

Human Exostoses 1 (EXT1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Exostoses 1 elisa. Alternative names of the recognized antigen: EXT
  • Ttv
  • Langer-Giedion Syndrome Chromosome Region
  • Glucuronosyl-N-acetylglucosaminyl-Proteoglycan 4-Alpha-N-Acetylglucosaminyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exostoses 1 (EXT1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Pig Exostoses 1 (EXT1) ELISA Kit

abx361331-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Exostoses 1 (EXT1) ELISA Kit

abx362218-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Exostoses 1 (EXT1) ELISA Kit

abx356158-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Exostoses 1 (EXT1) ELISA Kit

abx359562-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Exostoses 1 (EXT1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exostoses 1 (EXT1) Antibody

abx036070-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Exostoses 1 (EXT1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Exostoses 1 (EXT1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Exostoses 1 (EXT1)

  • EUR 472.74
  • EUR 229.00
  • EUR 1497.76
  • EUR 565.92
  • EUR 1031.84
  • EUR 379.00
  • EUR 3594.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16394
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Exostoses 1 expressed in: E.coli

ELISA kit for Human EXT1 (Exostoses 1)

ELK4143 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exostoses 1 (EXT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Exostoses 1 (EX
  • Show more
Description: A sandwich ELISA kit for detection of Exostoses 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human EXT1 (Exostoses 1)

E-EL-H1401 1 plate of 96 wells
EUR 534
  • Gentaur's EXT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human EXT1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human EXT1 (Exostoses 1) in samples from Serum, Plasma, Cell supernatant

Human Exostoses 1 (EXT1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Exostoses 1 (EXT1) CLIA Kit

abx196641-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Exostoses 1 (EXT1) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Guinea pig Exostoses 1 (EXT1) ELISA Kit

abx358022-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Exostoses 1 (EXT1) polyclonal antibody

ABP-PAB-10671 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

Exostoses 1 (Ext1) polyclonal antibody

ABP-PAB-10672 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

Exostoses 1 (EXT1) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CLIA kit for Human EXT1 (Exostoses 1)

E-CL-H0906 1 plate of 96 wells
EUR 584
  • Gentaur's EXT1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human EXT1 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human EXT1 (Exostoses 1) in samples from Serum, Plasma, Cell supernatant

Exostoses 1 (EXT1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EXT1 (Cys334~Arg549)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1)

Exostoses 1 (EXT1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EXT1 (Cys334~Arg549)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with APC.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EXT1 (Cys334~Arg549)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with Biotin.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EXT1 (Cys334~Arg549)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with Cy3.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EXT1 (Cys334~Arg549)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with FITC.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EXT1 (Cys334~Arg549)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with HRP.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EXT1 (Cys334~Arg549)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with PE.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EXT1 (Cys334~Arg549)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


EF006797 96 Tests
EUR 689

Human Exostosin- 1, EXT1 ELISA KIT

ELI-47672h 96 Tests
EUR 824

EXT1 ELISA Kit (Human) (OKCD01905)

OKCD01905 96 Wells
EUR 831
Description: Description of target: Glycosyltransferase required for the biosynthesis of heparan-sulfate. The EXT1/EXT2 complex possesses substantially higher glycosyltransferase activity than EXT1 or EXT2 alone. Appears to be a tumor suppressor. Required for the exosomal release of SDCBP, CD63 and syndecan.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.28 ng/mL

Bovine Exostosin- 1, EXT1 ELISA KIT

ELI-20574b 96 Tests
EUR 928

Mouse Exostosin- 1, Ext1 ELISA KIT

ELI-32744m 96 Tests
EUR 865

Mouse Exostosin 1 (EXT1) ELISA Kit

abx389228-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

DLR-EXTL1-Hu-48T 48T
EUR 554
  • Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

DLR-EXTL1-Hu-96T 96T
EUR 725
  • Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

RD-EXTL1-Hu-48Tests 48 Tests
EUR 563

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

RD-EXTL1-Hu-96Tests 96 Tests
EUR 783

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

RDR-EXTL1-Hu-48Tests 48 Tests
EUR 589

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

RDR-EXTL1-Hu-96Tests 96 Tests
EUR 820

Human Exostoses Like Protein 1(EXTL1)ELISA Kit

QY-E01124 96T
EUR 361

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

SEL477Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

SEL477Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

SEL477Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

SEL477Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Exostoses Like Protein 1 elisa. Alternative names of the recognized antigen: EXTL
  • Exostosin-Like 1
  • Glucuronosyl-N-Acetylglucosaminyl-Proteoglycan 4-Alpha-N-Acetylglucosaminyltransferase
  • Exostosin-L
  • Multiple exostosis-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Exostoses 2 (EXT2)ELISA Kit

201-12-2694 96 tests
EUR 440
  • This Exostoses 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Exostoses 2(EXT2)ELISA Kit

QY-E01125 96T
EUR 361

Ext1 ELISA Kit| Mouse Exostosin-1 ELISA Kit

EF014858 96 Tests
EUR 689

EXT1 ELISA Kit| Bovine Exostosin-1 ELISA Kit

EF011372 96 Tests
EUR 689

ELISA kit for Human EXTL1 (Exostoses Like Protein 1)

ELK6285 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exostoses Like Protein 1 (EXTL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to E
  • Show more
Description: A sandwich ELISA kit for detection of Exostoses Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Exostosin 1 (EXT1) Antibody

abx117178-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody

abx029097-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody

abx029097-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Exostoses Like Protein 1 (EXTL1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXT1 antibody

70R-5709 50 ug
EUR 467
Description: Rabbit polyclonal EXT1 antibody

EXT1 antibody

70R-5710 50 ug
EUR 467
Description: Rabbit polyclonal EXT1 antibody

EXT1 Antibody

ABD6764 100 ug
EUR 438

EXT1 Antibody

32560-100ul 100ul
EUR 252

EXT1 Antibody

DF6764 200ul
EUR 304
Description: EXT1 Antibody detects endogenous levels of total EXT1.

EXT1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

EXT1 Antibody

CSB-PA007899KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

EXT1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000


YF-PA11639 100 ug
EUR 403
Description: Rabbit polyclonal to Ext1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Exostoses Like Protein 1 (EXTL1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human EXT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXT1 Recombinant Protein (Human)

RP011083 100 ug Ask for price

Exostosin 1 (EXT1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EXT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0704602 1.0 ug DNA
EUR 154

Exostoses (Multiple)-Like 1 (EXTL1) Antibody

abx030322-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 1 (EXTL1) Antibody

abx030322-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Exostoses Like Protein 1 (EXTL1) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Exostoses Like Protein 1 (EXTL1) Antibody

  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Exostoses Like Protein 1 (EXTL1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exostoses Like Protein 1 (EXTL1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

EXT1 Conjugated Antibody

C32560 100ul
EUR 397

EXT1 Rabbit pAb

A2030-100ul 100 ul
EUR 308

EXT1 Rabbit pAb

A2030-200ul 200 ul
EUR 459

EXT1 Rabbit pAb

A2030-20ul 20 ul
EUR 183

EXT1 Rabbit pAb

A2030-50ul 50 ul
EUR 223

EXT1 Blocking Peptide

33R-3726 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXT1 antibody, catalog no. 70R-5710

EXT1 Blocking Peptide

33R-4777 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXT1 antibody, catalog no. 70R-5709

EXT1 Blocking Peptide

DF6764-BP 1mg
EUR 195

EXT1 cloning plasmid

CSB-CL620959HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2241
  • Sequence: atgcaggccaaaaaacgctatttcatcctgctctcagctggctcttgtctcgcccttttgttttatttcggaggcttgcagtttagggcatcgaggagccacagccggagagaagaacacagcggtaggaatggcttgcaccaccccagtccggatcatttctggccccgcttcc
  • Show more
Description: A cloning plasmid for the EXT1 gene.

pENTR223-EXT1 vector

PVT11765 2 ug
EUR 304

Anti-EXT1 antibody

STJ23589 100 µl
EUR 277
Description: This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses.

Anti-Ext1 (5A5)

YF-MA12917 100 ug
EUR 363
Description: Mouse monoclonal to Ext1

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

EXT1 ORF Vector (Human) (pORF)

ORF003695 1.0 ug DNA
EUR 95


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Polyclonal EXT1 Antibody (Center)

AMM08624G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EXT1 (Center). This antibody is tested and proven to work in the following applications:

Mouse EXT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXT1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EXT1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EXT1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EXT1 Recombinant Protein (Rat)

RP200135 100 ug Ask for price

EXT1 Recombinant Protein (Mouse)

RP132545 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Ext1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4003902 1.0 ug DNA
EUR 154

Ext1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7597802 1.0 ug DNA
EUR 154

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

EXT1 sgRNA CRISPR Lentivector set (Human)

K0704601 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit

EL3502-1 96 Well Plate
EUR 477

Human TGF-beta-1 AssayMax ELISA Kit

ET3102-1 96 Well Plate
EUR 477

Human PAI-1/tPA AssayMax ELISA Kit

EP1105-1 96 Well Plate
EUR 417

Human EXT1(Exostoses 1) ELISA Kit