Human EXT1(Exostoses 1) ELISA Kit
Human Exostoses 1 (EXT1) ELISA Kit |
RDR-EXT1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Exostoses 1 (EXT1) ELISA Kit |
RDR-EXT1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human EXT1(Exostoses 1) ELISA Kit |
EH3023 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.781-50 ng/ml
- Uniprot ID: Q16394
- Alias: EXT1/LGCR/TRPS2/TTV/EC 2.4.1.224/EC 2.4.1.225/exostoses(multiple) 1/exostosin 1/exostosin-1/EXT/Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase/Glucurono
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml |
Human Exostoses 1 (EXT1) ELISA Kit |
20-abx151458 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Exostoses 1 (EXT1) ELISA Kit |
abx252416-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Exostoses 1 (EXT1)ELISA Kit |
201-12-2693 |
SunredBio |
96 tests |
EUR 440 |
- This Exostoses 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Exostoses 1 ELISA Kit (EXT1) |
RK01332 |
Abclonal |
96 Tests |
EUR 521 |
Human Exostoses 1 (EXT1) ELISA Kit |
SEG239Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids. |
Human Exostoses 1 (EXT1) ELISA Kit |
SEG239Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids. |
Human Exostoses 1 (EXT1) ELISA Kit |
SEG239Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids. |
Human Exostoses 1 (EXT1) ELISA Kit |
SEG239Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids. |
Human Exostoses 1 (EXT1) ELISA Kit |
4-SEG239Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Exostoses 1 elisa. Alternative names of the recognized antigen: EXT
- Ttv
- LGCR, LGS
- Langer-Giedion Syndrome Chromosome Region
- Glucuronosyl-N-acetylglucosaminyl-Proteoglycan 4-Alpha-N-Acetylglucosaminyltransferase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exostoses 1 (EXT1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Pig Exostoses 1 (EXT1) ELISA Kit |
abx361331-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Exostoses 1 (EXT1) ELISA Kit |
abx362218-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Exostoses 1 (EXT1) ELISA Kit |
abx356158-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Exostoses 1 (EXT1) ELISA Kit |
abx359562-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Exostoses 1 (EXT1) Antibody |
20-abx141663 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Exostoses 1 (EXT1) Antibody |
abx036070-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Exostoses 1 (EXT1) Antibody |
20-abx100786 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Exostoses 1 (EXT1) Antibody |
20-abx172309 |
Abbexa |
|
|
|
Recombinant Exostoses 1 (EXT1) |
4-RPG239Hu01 |
Cloud-Clone |
-
EUR 472.74
-
EUR 229.00
-
EUR 1497.76
-
EUR 565.92
-
EUR 1031.84
-
EUR 379.00
-
EUR 3594.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q16394
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Exostoses 1 expressed in: E.coli |
ELISA kit for Human EXT1 (Exostoses 1) |
ELK4143 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exostoses 1 (EXT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Exostoses 1 (EX
- Show more
|
Description: A sandwich ELISA kit for detection of Exostoses 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human EXT1 (Exostoses 1) |
E-EL-H1401 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's EXT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human EXT1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human EXT1 (Exostoses 1) in samples from Serum, Plasma, Cell supernatant |
Human Exostoses 1 (EXT1) CLIA Kit |
20-abx495135 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Exostoses 1 (EXT1) CLIA Kit |
abx196641-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Exostoses 1 (EXT1) Protein |
20-abx066473 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2026.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Guinea pig Exostoses 1 (EXT1) ELISA Kit |
abx358022-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Exostoses 1 (EXT1) polyclonal antibody |
ABP-PAB-10671 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Genetic Disease Markers
- Brand:
|
Exostoses 1 (Ext1) polyclonal antibody |
ABP-PAB-10672 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Genetic Disease Markers
- Brand:
|
Exostoses 1 (EXT1) Antibody (Biotin) |
20-abx272389 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
CLIA kit for Human EXT1 (Exostoses 1) |
E-CL-H0906 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's EXT1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human EXT1 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human EXT1 (Exostoses 1) in samples from Serum, Plasma, Cell supernatant |
Exostoses 1 (EXT1) Polyclonal Antibody (Human) |
4-PAG239Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EXT1 (Cys334~Arg549)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1) |
Exostoses 1 (EXT1) Polyclonal Antibody (Human), APC |
4-PAG239Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EXT1 (Cys334~Arg549)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with APC. |
Exostoses 1 (EXT1) Polyclonal Antibody (Human), Biotinylated |
4-PAG239Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EXT1 (Cys334~Arg549)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with Biotin. |
Exostoses 1 (EXT1) Polyclonal Antibody (Human), Cy3 |
4-PAG239Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EXT1 (Cys334~Arg549)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with Cy3. |
Exostoses 1 (EXT1) Polyclonal Antibody (Human), FITC |
4-PAG239Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EXT1 (Cys334~Arg549)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with FITC. |
Exostoses 1 (EXT1) Polyclonal Antibody (Human), HRP |
4-PAG239Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EXT1 (Cys334~Arg549)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with HRP. |
Exostoses 1 (EXT1) Polyclonal Antibody (Human), PE |
4-PAG239Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EXT1 (Cys334~Arg549)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with PE. |
Exostoses 1 (EXT1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAG239Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EXT1 (Cys334~Arg549)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with APC-Cy7. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
EXT1 ELISA Kit (Human) (OKCD01905) |
OKCD01905 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Glycosyltransferase required for the biosynthesis of heparan-sulfate. The EXT1/EXT2 complex possesses substantially higher glycosyltransferase activity than EXT1 or EXT2 alone. Appears to be a tumor suppressor. Required for the exosomal release of SDCBP, CD63 and syndecan.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.28 ng/mL |
Mouse Exostosin 1 (EXT1) ELISA Kit |
abx389228-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
20-abx151461 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
DLR-EXTL1-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
DLR-EXTL1-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
RD-EXTL1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
RD-EXTL1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
RDR-EXTL1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
RDR-EXTL1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
SEL477Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids. |
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
SEL477Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids. |
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
SEL477Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids. |
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
SEL477Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids. |
Human Exostoses Like Protein 1 (EXTL1) ELISA Kit |
4-SEL477Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Exostoses Like Protein 1 elisa. Alternative names of the recognized antigen: EXTL
- Exostosin-Like 1
- Glucuronosyl-N-Acetylglucosaminyl-Proteoglycan 4-Alpha-N-Acetylglucosaminyltransferase
- Exostosin-L
- Multiple exostosis-like protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Exostoses 2 (EXT2)ELISA Kit |
201-12-2694 |
SunredBio |
96 tests |
EUR 440 |
- This Exostoses 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA kit for Human EXTL1 (Exostoses Like Protein 1) |
ELK6285 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exostoses Like Protein 1 (EXTL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to E
- Show more
|
Description: A sandwich ELISA kit for detection of Exostoses Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Exostosin 1 (EXT1) Antibody |
abx117178-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Exostosin 1 (EXT1) Antibody |
20-abx001647 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Exostosin 1 (EXT1) Antibody |
abx029097-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Exostosin 1 (EXT1) Antibody |
abx029097-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Exostosin 1 (EXT1) Antibody |
20-abx302428 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Exostoses Like Protein 1 (EXTL1) CLIA Kit |
20-abx495930 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
EXT1 siRNA |
20-abx915837 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EXT1 siRNA |
20-abx915838 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EXT1 antibody |
70R-5709 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal EXT1 antibody |
EXT1 antibody |
70R-5710 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal EXT1 antibody |
EXT1 Antibody |
32560-100ul |
SAB |
100ul |
EUR 252 |
EXT1 Antibody |
DF6764 |
Affbiotech |
200ul |
EUR 304 |
Description: EXT1 Antibody detects endogenous levels of total EXT1. |
EXT1 Antibody |
CSB-PA007899KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
EXT1 Antibody |
CSB-PA007899KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
EXT1 Antibody |
1-CSB-PA620959LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
anti-Ext1 |
YF-PA11639 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Ext1 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human Exostoses Like Protein 1 (EXTL1) Protein |
20-abx653329 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human EXT1 shRNA Plasmid |
20-abx951482 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EXT1 Recombinant Protein (Human) |
RP011083 |
ABM |
100 ug |
Ask for price |
Exostosin 1 (EXT1) Antibody (HRP) |
20-abx314500 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Exostosin 1 (EXT1) Antibody (FITC) |
20-abx314501 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Exostosin 1 (EXT1) Antibody (Biotin) |
20-abx314502 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
EXT1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0704602 |
ABM |
1.0 ug DNA |
EUR 154 |
Exostoses (Multiple)-Like 1 (EXTL1) Antibody |
abx030322-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Exostoses (Multiple)-Like 1 (EXTL1) Antibody |
abx030322-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Exostoses Like Protein 1 (EXTL1) Antibody |
20-abx172310 |
Abbexa |
|
|
|
Exostoses Like Protein 1 (EXTL1) Antibody |
20-abx176347 |
Abbexa |
|
|
|
Exostoses Like Protein 1 (EXTL1) Antibody |
20-abx211615 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exostoses Like Protein 1 (EXTL1) Antibody |
20-abx211616 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EXT1 Conjugated Antibody |
C32560 |
SAB |
100ul |
EUR 397 |
EXT1 Rabbit pAb |
A2030-100ul |
Abclonal |
100 ul |
EUR 308 |
EXT1 Rabbit pAb |
A2030-200ul |
Abclonal |
200 ul |
EUR 459 |
EXT1 Rabbit pAb |
A2030-20ul |
Abclonal |
20 ul |
EUR 183 |
EXT1 Rabbit pAb |
A2030-50ul |
Abclonal |
50 ul |
EUR 223 |
EXT1 Blocking Peptide |
33R-3726 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXT1 antibody, catalog no. 70R-5710 |
EXT1 Blocking Peptide |
33R-4777 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXT1 antibody, catalog no. 70R-5709 |
EXT1 Blocking Peptide |
DF6764-BP |
Affbiotech |
1mg |
EUR 195 |
EXT1 cloning plasmid |
CSB-CL620959HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2241
- Sequence: atgcaggccaaaaaacgctatttcatcctgctctcagctggctcttgtctcgcccttttgttttatttcggaggcttgcagtttagggcatcgaggagccacagccggagagaagaacacagcggtaggaatggcttgcaccaccccagtccggatcatttctggccccgcttcc
- Show more
|
Description: A cloning plasmid for the EXT1 gene. |
Anti-EXT1 antibody |
STJ23589 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. |
Anti-Ext1 (5A5) |
YF-MA12917 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Ext1 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
EXT1 ORF Vector (Human) (pORF) |
ORF003695 |
ABM |
1.0 ug DNA |
EUR 95 |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Polyclonal EXT1 Antibody (Center) |
AMM08624G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EXT1 (Center). This antibody is tested and proven to work in the following applications: |
Mouse EXT1 shRNA Plasmid |
20-abx970248 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EXT1 Antibody, HRP conjugated |
1-CSB-PA620959LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EXT1 Antibody, FITC conjugated |
1-CSB-PA620959LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EXT1 Antibody, Biotin conjugated |
1-CSB-PA620959LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
EXT1 Recombinant Protein (Rat) |
RP200135 |
ABM |
100 ug |
Ask for price |
EXT1 Recombinant Protein (Mouse) |
RP132545 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Ext1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4003902 |
ABM |
1.0 ug DNA |
EUR 154 |
Ext1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7597802 |
ABM |
1.0 ug DNA |
EUR 154 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
EXT1 sgRNA CRISPR Lentivector set (Human) |
K0704601 |
ABM |
3 x 1.0 ug |
EUR 339 |
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Human Lipocalin-1 (LCN1) AssayMax ELISA Kit |
EL3502-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human TGF-beta-1 AssayMax ELISA Kit |
ET3102-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human PAI-1/tPA AssayMax ELISA Kit |
EP1105-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human EXT1(Exostoses 1) ELISA Kit