Human CPA4(Carboxypeptidase A4) ELISA Kit
Human Carboxypeptidase A4 (CPA4) ELISA Kit |
RDR-CPA4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Carboxypeptidase A4 (CPA4) ELISA Kit |
RD-CPA4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Carboxypeptidase A4 (CPA4) ELISA Kit |
RD-CPA4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Carboxypeptidase A4(CPA4) ELISA kit |
E01C1992-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A4(CPA4) ELISA kit |
E01C1992-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A4(CPA4) ELISA kit |
E01C1992-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A4 (CPA4) ELISA Kit |
20-abx150933 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Carboxypeptidase A4 (CPA4) ELISA Kit |
SEF317Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Carboxypeptidase A4 (CPA4) ELISA Kit |
SEF317Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Carboxypeptidase A4 (CPA4) ELISA Kit |
SEF317Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Carboxypeptidase A4 (CPA4) ELISA Kit |
SEF317Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Carboxypeptidase A4 (CPA4) ELISA Kit |
4-SEF317Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Carboxypeptidase A4 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase A4 (CPA4) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Carboxypeptidase A4 (CPA4) Antibody |
20-abx128273 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Carboxypeptidase A4 (CPA4) Antibody |
abx145278-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Carboxypeptidase A4 (CPA4) Antibody |
20-abx149520 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Carboxypeptidase A4 (CPA4) Antibody |
20-abx171565 |
Abbexa |
|
|
|
Carboxypeptidase A4 (CPA4) Antibody |
abx033337-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Carboxypeptidase A4 (CPA4) Antibody |
abx033337-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Recombinant Carboxypeptidase A4 (CPA4) |
4-RPF317Hu01 |
Cloud-Clone |
-
EUR 474.53
-
EUR 230.00
-
EUR 1504.48
-
EUR 568.16
-
EUR 1036.32
-
EUR 380.00
-
EUR 3611.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9UI42
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 44.9kDa
- Isoelectric Point: 6
|
Description: Recombinant Human Carboxypeptidase A4 expressed in: E.coli |
Rat Carboxypeptidase A4(CPA4) ELISA kit |
E02C1992-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Carboxypeptidase A4(CPA4) ELISA kit |
E02C1992-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Carboxypeptidase A4(CPA4) ELISA kit |
E02C1992-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Carboxypeptidase A4(CPA4) ELISA kit |
E03C1992-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Carboxypeptidase A4(CPA4) ELISA kit |
E03C1992-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Carboxypeptidase A4(CPA4) ELISA kit |
E03C1992-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Carboxypeptidase A4(CPA4) ELISA kit |
E06C1992-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Carboxypeptidase A4(CPA4) ELISA kit |
E06C1992-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Carboxypeptidase A4(CPA4) ELISA kit |
E06C1992-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Carboxypeptidase A4(CPA4) ELISA kit |
E04C1992-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Carboxypeptidase A4(CPA4) ELISA kit |
E04C1992-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Carboxypeptidase A4(CPA4) ELISA kit |
E04C1992-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Carboxypeptidase A4(CPA4) ELISA kit |
E09C1992-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Carboxypeptidase A4(CPA4) ELISA kit |
E09C1992-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Carboxypeptidase A4(CPA4) ELISA kit |
E09C1992-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Carboxypeptidase A4(CPA4) ELISA kit |
E08C1992-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Carboxypeptidase A4(CPA4) ELISA kit |
E08C1992-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Carboxypeptidase A4(CPA4) ELISA kit |
E08C1992-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Carboxypeptidase A4(CPA4) ELISA kit |
E07C1992-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Carboxypeptidase A4(CPA4) ELISA kit |
E07C1992-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Carboxypeptidase A4(CPA4) ELISA kit |
E07C1992-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase A4 (CPA4) Protein |
20-abx166634 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2026.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Carboxypeptidase A4 (CPA4) CLIA Kit |
20-abx494859 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human CPA4 (Carboxypeptidase A4) |
ELK4126 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase A4 (CPA4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxy
- Show more
|
Description: A sandwich ELISA kit for detection of Carboxypeptidase A4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Guinea pig Carboxypeptidase A4(CPA4) ELISA kit |
E05C1992-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Carboxypeptidase A4(CPA4) ELISA kit |
E05C1992-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Carboxypeptidase A4(CPA4) ELISA kit |
E05C1992-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human) |
4-PAF317Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPA4 (Lys55~Tyr421)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4) |
CPA4 Carboxypeptidase A4 Human Recombinant Protein |
PROTQ9UI42 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: CPA4 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 413 amino acids (17-421a.a.) and having a molecular mass of 46.6kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa)._x000D_ CPA4 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), APC |
4-PAF317Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPA4 (Lys55~Tyr421)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with APC. |
Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), Biotinylated |
4-PAF317Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPA4 (Lys55~Tyr421)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with Biotin. |
Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), Cy3 |
4-PAF317Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPA4 (Lys55~Tyr421)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with Cy3. |
Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), FITC |
4-PAF317Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPA4 (Lys55~Tyr421)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with FITC. |
Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), HRP |
4-PAF317Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPA4 (Lys55~Tyr421)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with HRP. |
Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), PE |
4-PAF317Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPA4 (Lys55~Tyr421)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with PE. |
Recombinant Mouse Carboxypeptidase A4/CPA4 (C-6His) |
CJ13-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol, pH8.0. |
Recombinant Mouse Carboxypeptidase A4/CPA4 (C-6His) |
CJ13-1mg |
Novoprotein |
1mg |
EUR 2486 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol, pH8.0. |
Recombinant Mouse Carboxypeptidase A4/CPA4 (C-6His) |
CJ13-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol, pH8.0. |
Recombinant Mouse Carboxypeptidase A4/CPA4 (C-6His) |
CJ13-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol, pH8.0. |
Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF317Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPA4 (Lys55~Tyr421)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with APC-Cy7. |
Carboxypeptidase A4, human recombinant |
P1034-10 |
Biovision |
|
EUR 164 |
Carboxypeptidase A4, human recombinant |
P1034-50 |
Biovision |
|
EUR 588 |
CPA4 ELISA Kit (Human) (OKCD08770) |
OKCD08770 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene is a member of the carboxypeptidase A/B subfamily, and it is located in a cluster with three other family members on chromosome 7. Carboxypeptidases are zinc-containing exopeptidases that catalyze the release of carboxy-terminal amino acids, and are synthesized as zymogens that are activated by proteolytic cleavage. This gene could be involved in the histone hyperacetylation pathway. It is imprinted and may be a strong candidate gene for prostate cancer aggressiveness.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.065ng/mL |
CPA4 ELISA Kit (Human) (OKDD00203) |
OKDD00203 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene is a member of the carboxypeptidase A/B subfamily, and it is located in a cluster with three other family members on chromosome 7. Carboxypeptidases are zinc-containing exopeptidases that catalyze the release of carboxy-terminal amino acids, and are synthesized as zymogens that are activated by proteolytic cleavage. This gene could be involved in the histone hyperacetylation pathway. It is imprinted and may be a strong candidate gene for prostate cancer aggressiveness.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.051 ng/mL |
Human apoprotein A4,apo-A4 ELISA Kit |
201-12-1429 |
SunredBio |
96 tests |
EUR 440 |
- This apoprotein A4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human apoprotein A4(apo-A4)ELISA Kit |
GA-E1445HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human apoprotein A4(apo-A4)ELISA Kit |
GA-E1445HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
CPA4 Antibody |
45848-100ul |
SAB |
100ul |
EUR 252 |
CPA4 Antibody |
45848-50ul |
SAB |
50ul |
EUR 187 |
CPA4 Antibody |
DF9336 |
Affbiotech |
200ul |
EUR 304 |
Description: CPA4 Antibody detects endogenous levels of total CPA4. |
CPA4 siRNA |
20-abx912637 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CPA4 siRNA |
20-abx912638 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Human Annexin A4 (ANX-A4) |
KTE62440-48T |
Abbkine |
48T |
EUR 354 |
- Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along ex
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Annexin A4 (ANX-A4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Annexin A4 (ANX-A4) |
KTE62440-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along ex
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Annexin A4 (ANX-A4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Annexin A4 (ANX-A4) |
KTE62440-96T |
Abbkine |
96T |
EUR 572 |
- Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along ex
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Annexin A4 (ANX-A4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Carboxypeptidase B1 ELISA kit |
E01C0730-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase B1 ELISA kit |
E01C0730-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carboxypeptidase B1 ELISA kit |
E01C0730-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CPA4 shRNA Plasmid |
20-abx959601 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CPA4 Recombinant Protein (Human) |
RP007831 |
ABM |
100 ug |
Ask for price |
Human Apolipoprotein A4 ELISA kit |
E01A0511-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apolipoprotein A4 ELISA kit |
E01A0511-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apolipoprotein A4 ELISA kit |
E01A0511-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukotriene A4 ELISA kit |
E01L0035-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukotriene A4 ELISA kit |
E01L0035-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Leukotriene A4 ELISA kit |
E01L0035-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lipoxin A4 ELISA kit |
E01L0275-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Lipoxin A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lipoxin A4 ELISA kit |
E01L0275-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Lipoxin A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lipoxin A4 ELISA kit |
E01L0275-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Lipoxin A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Recombinant Carboxypeptidase A4 Protein (Gly 17-Tyr 421) [His] |
VAng-1163Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 6099 |
Description: Human Carboxypeptidase A4 (CPA4), His tag, is expressed in HEK 293 cells. (Uniprot ID: AAH52289) |
Recombinant Carboxypeptidase A4 Protein (Gly 17-Tyr 421) [His] |
VAng-1163Lsx-50g |
Creative Biolabs |
50 µg |
EUR 916 |
Description: Human Carboxypeptidase A4 (CPA4), His tag, is expressed in HEK 293 cells. (Uniprot ID: AAH52289) |
CPA4 Blocking Peptide |
DF9336-BP |
Affbiotech |
1mg |
EUR 195 |
CPA4 Conjugated Antibody |
C45848 |
SAB |
100ul |
EUR 397 |
CPA4 cloning plasmid |
CSB-CL005878HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1266
- Sequence: atgaggtggatactgttcattggggcccttattgggtccagcatctgtggccaagaaaaattttttggggaccaagttttgaggattaatgtcagaaatggagacgagatcagcaaattgagtcaactagtgaattcaaacaacttgaagctcaatttctggaaatctccctcct
- Show more
|
Description: A cloning plasmid for the CPA4 gene. |
CPA4 Rabbit pAb |
A17701-100ul |
Abclonal |
100 ul |
EUR 308 |
CPA4 Rabbit pAb |
A17701-200ul |
Abclonal |
200 ul |
EUR 459 |
CPA4 Rabbit pAb |
A17701-20ul |
Abclonal |
20 ul |
EUR 183 |
CPA4 Rabbit pAb |
A17701-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-CPA4 antibody |
STJ119744 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the carboxypeptidase A/B subfamily, and it is located in a cluster with three other family members on chromosome 7. Carboxypeptidases are zinc-containing exopeptidases that catalyze the release of carboxy-terminal amino acids, and are synthesized as zymogens that are activated by proteolytic cleavage. This gene could be involved in the histone hyperacetylation pathway. It is imprinted and may be a strong candidate gene for prostate cancer aggressiveness. [provided by RefSeq, Jul 2008] |
Anti-CPA4 (1F4) |
YF-MA18444 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CPA4 |
Lipoxin A4 ELISA Kit |
E4788-100 |
Biovision |
96 assays |
EUR 581 |
Human Carboxypeptidase N1 (CPN1)ELISA Kit |
201-12-2436 |
SunredBio |
96 tests |
EUR 440 |
- This Carboxypeptidase N1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Carboxypeptidase N2 (CPN2)ELISA Kit |
201-12-2437 |
SunredBio |
96 tests |
EUR 440 |
- This Carboxypeptidase N2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Carboxypeptidase E (CPE) ELISA Kit |
DLR-CPE-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carboxypeptidase E (CPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase E (CPE) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Carboxypeptidase E (CPE) ELISA Kit |
DLR-CPE-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carboxypeptidase E (CPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase E (CPE) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Carboxypeptidase M (CPM) ELISA Kit |
DLR-CPM-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carboxypeptidase M (CPM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase M (CPM) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Carboxypeptidase M (CPM) ELISA Kit |
DLR-CPM-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carboxypeptidase M (CPM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase M (CPM) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Carboxypeptidase N1 (CPN1) ELISA Kit |
DLR-CPN1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carboxypeptidase N1 (CPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase N1 (CPN1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Carboxypeptidase N1 (CPN1) ELISA Kit |
DLR-CPN1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carboxypeptidase N1 (CPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase N1 (CPN1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Carboxypeptidase Z (CPZ) ELISA Kit |
DLR-CPZ-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carboxypeptidase Z (CPZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase Z (CPZ) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Carboxypeptidase Z (CPZ) ELISA Kit |
DLR-CPZ-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carboxypeptidase Z (CPZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase Z (CPZ) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human CPA2/ Carboxypeptidase A2 ELISA Kit |
E0543Hu |
Sunlong |
1 Kit |
EUR 571 |
Human CPA4(Carboxypeptidase A4) ELISA Kit