Human AOAH(Acyloxyacyl Hydrolase) ELISA Kit
 ELISA Kit) Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
RDR-AOAH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
RDR-AOAH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
RD-AOAH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
RD-AOAH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
ELISA Kit) Human Acyloxyacyl Hydrolase (AOAH)ELISA Kit |
|
201-12-2818 |
SunredBio |
96 tests |
EUR 440 |
- This Acyloxyacyl Hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 ELISA kit) Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E01A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E01A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E01A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
20-abx150541 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
CSB-EL001853HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
1-CSB-EL001853HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 Human Acyloxyacyl hydrolase, AOAH ELISA KIT |
|
ELI-34429h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
SEJ634Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
SEJ634Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
SEJ634Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
SEJ634Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
|
4-SEJ634Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Acyloxyacyl Hydrolase elisa. Alternative names of the recognized antigen: n/a
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
 Antibody) Acyloxyacyl Hydrolase (AOAH) Antibody |
|
20-abx125520 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Acyloxyacyl Hydrolase (AOAH) Antibody |
|
20-abx128358 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Acyloxyacyl Hydrolase (AOAH) Antibody |
|
20-abx148216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Acyloxyacyl Hydrolase (AOAH) Antibody |
|
20-abx171073 |
Abbexa |
|
|
|
|
Acyloxyacyl Hydrolase (AOAH) Antibody |
|
abx029449-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Acyloxyacyl Hydrolase (AOAH) Antibody |
|
abx029449-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Acyloxyacyl Hydrolase (AOAH) Antibody |
|
20-abx318749 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Acyloxyacyl Hydrolase (AOAH) Antibody |
|
abx230453-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
) Recombinant Acyloxyacyl Hydrolase (AOAH) |
|
4-RPJ634Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P28039
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.7kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Acyloxyacyl Hydrolase expressed in: E.coli |
 ELISA kit) Rat Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E02A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E02A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E02A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Goat Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E06A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E06A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E06A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Mouse Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E03A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E03A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E03A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Rabbit Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E04A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E04A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E04A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Pig Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E07A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E07A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E07A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Dog Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E08A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E08A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E08A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Monkey Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E09A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E09A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E09A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Mouse Acyloxyacyl hydrolase, Aoah ELISA KIT |
|
ELI-24219m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
CSB-EL001853MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
1-CSB-EL001853MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA Kit) Mouse Acyloxyacyl hydrolase (AOAH) ELISA Kit |
|
abx388507-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Rabbit Acyloxyacyl hydrolase, AOAH ELISA KIT |
|
ELI-49571Ra |
Lifescience Market |
96 Tests |
EUR 928 |
 Protein) Human Acyloxyacyl Hydrolase (AOAH) Protein |
|
20-abx166775 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 CLIA Kit) Human Acyloxyacyl Hydrolase (AOAH) CLIA Kit |
|
20-abx495751 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Human AOAH (Acyloxyacyl Hydrolase) |
|
ELK3978 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Acyloxyacyl Hydrolase (AOAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Acylo
- Show more
|
|
Description: A sandwich ELISA kit for detection of Acyloxyacyl Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 Antibody (HRP)) Acyloxyacyl Hydrolase (AOAH) Antibody (HRP) |
|
20-abx315584 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Acyloxyacyl Hydrolase (AOAH) Antibody (FITC) |
|
20-abx315585 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Acyloxyacyl Hydrolase (AOAH) Antibody (Biotin) |
|
20-abx315586 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 ELISA kit) Guinea pig Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E05A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E05A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Acyloxyacyl hydrolase(AOAH) ELISA kit |
|
E05A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Aoah ELISA Kit| Mouse Acyloxyacyl hydrolase ELISA Kit |
|
EF014132 |
Lifescience Market |
96 Tests |
EUR 689 |
 Polyclonal Antibody (Human, Pig)) Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig) |
|
4-PAJ634Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AOAH (Ser24~Gln300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH) |
 Polyclonal Antibody (Human, Pig), APC) Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), APC |
|
4-PAJ634Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AOAH (Ser24~Gln300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with APC. |
 Polyclonal Antibody (Human, Pig), Biotinylated) Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), Biotinylated |
|
4-PAJ634Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AOAH (Ser24~Gln300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human, Pig), Cy3) Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), Cy3 |
|
4-PAJ634Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AOAH (Ser24~Gln300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human, Pig), FITC) Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), FITC |
|
4-PAJ634Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AOAH (Ser24~Gln300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human, Pig), HRP) Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), HRP |
|
4-PAJ634Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AOAH (Ser24~Gln300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human, Pig), PE) Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), PE |
|
4-PAJ634Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AOAH (Ser24~Gln300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with PE. |
 Polyclonal Antibody (Human, Pig), APC-Cy7) Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), APC-Cy7 |
|
4-PAJ634Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AOAH (Ser24~Gln300)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with APC-Cy7. |
 anti-Acyloxyacyl Hydrolase |
|
YF-PA10235 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to Acyloxyacyl Hydrolase |
 (OKCD00573)) AOAH ELISA Kit (Human) (OKCD00573) |
|
OKCD00573 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Removes the secondary (acyloxyacyl-linked) fatty acyl chains from the lipid A region of bacterial lipopolysaccharides. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL |
 (OKDD00125)) AOAH ELISA Kit (Human) (OKDD00125) |
|
OKDD00125 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: This locus encodes both the light and heavy subunits of acyloxyacyl hydrolase. The encoded enzyme catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides, effectively detoxifying these molecules. The encoded protein may play a role in modulating host inflammatory response to gram-negative bacteria. Alternatively spliced transcript variants have been described.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 AOAH Antibody |
|
46930-100ul |
SAB |
100ul |
EUR 252 |
AOAH Antibody |
|
45747-100ul |
SAB |
100ul |
EUR 252 |
AOAH Antibody |
|
45747-50ul |
SAB |
50ul |
EUR 187 |
AOAH Antibody |
|
1-CSB-PA001853LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against AOAH. Recognizes AOAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
AOAH Antibody |
|
DF9158 |
Affbiotech |
200ul |
EUR 304 |
|
Description: AOAH Antibody detects endogenous levels of total AOAH. |
 AOAH siRNA |
|
20-abx907683 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AOAH siRNA |
|
20-abx907684 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Human AOAH shRNA Plasmid |
|
20-abx950215 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) AOAH Recombinant Protein (Human) |
|
RP001396 |
ABM |
100 ug |
Ask for price |
 AOAH Rabbit pAb |
|
A10366-100ul |
Abclonal |
100 ul |
EUR 308 |
AOAH Rabbit pAb |
|
A10366-200ul |
Abclonal |
200 ul |
EUR 459 |
AOAH Rabbit pAb |
|
A10366-20ul |
Abclonal |
20 ul |
EUR 183 |
AOAH Rabbit pAb |
|
A10366-50ul |
Abclonal |
50 ul |
EUR 223 |
 AOAH Blocking Peptide |
|
DF9158-BP |
Affbiotech |
1mg |
EUR 195 |
 AOAH Conjugated Antibody |
|
C45747 |
SAB |
100ul |
EUR 397 |
AOAH Conjugated Antibody |
|
C46930 |
SAB |
100ul |
EUR 397 |
 AOAH cloning plasmid |
|
CSB-CL001853HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1728
- Sequence: atgcagtccccctggaaaatccttacggtggcgcctctattcttgctcctgtctcttcagtcctcagcctctccagccaacgatgaccagtccaggcccagcctctcgaatgggcacacctgtgtagggtgtgtgctggtggtgtctgtaatagaacagcttgctcaagttcaca
- Show more
|
|
Description: A cloning plasmid for the AOAH gene. |
 AOAH Polyclonal Antibody |
|
ABP57779-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340
- Applications tips:
|
|
Description: A polyclonal antibody for detection of AOAH from Human, Mouse. This AOAH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340 |
AOAH Polyclonal Antibody |
|
ABP57779-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340
- Applications tips:
|
|
Description: A polyclonal antibody for detection of AOAH from Human, Mouse. This AOAH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340 |
AOAH Polyclonal Antibody |
|
ABP57779-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340
- Applications tips:
|
|
Description: A polyclonal antibody for detection of AOAH from Human, Mouse. This AOAH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340 |
AOAH Polyclonal Antibody |
|
ES9349-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against AOAH from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AOAH Polyclonal Antibody |
|
ES9349-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against AOAH from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 anti- AOAH antibody |
|
FNab00453 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IHC: 1:20-1:200
- Immunogen: acyloxyacyl hydrolase(neutrophil)
- Uniprot ID: P28039
- Gene ID: 313
- Research Area: Metabolism
|
|
Description: Antibody raised against AOAH |
 Anti-AOAH antibody |
|
STJ112403 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This locus encodes both the light and heavy subunits of acyloxyacyl hydrolase. The encoded enzyme catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides, effectively detoxifying these molecules. The encoded protein may play a role in modulating host inflammatory response to gram-negative bacteria. Alternatively spliced transcript variants have been described. |
Anti-AOAH antibody |
|
STJ190507 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to AOAH |
 ELISA Kit) Human Bleomycin Hydrolase (BLMH) ELISA Kit |
|
DLR-BLMH-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human AOAH(Acyloxyacyl Hydrolase) ELISA Kit
ELISA Kit)
